The following population, C, has no limits on food resources or space: Population size = 500 • Births = 240 %3D Deaths = 170 %3D How many individuals will be in the population at the start of the second generat
Q: Why did it take so long for scientists to figure out that infections are caused by bacteria? What we...
A: Bacteria is prokaryotic microorganism.
Q: How would you explain the importance of tropicalrain forests (Core Case Study) to people who thinkth...
A: Rainforests are home to some of the world's most significant trees. Rainforests are classified into ...
Q: Chose an enzyme important in viral replication you want to target (examples: DNA polymerase, reverse...
A: Viruses are different from other microorganisms. They are obligate parasites and are only infectious...
Q: What are the two key concepts for this section?Define freshwater. Explain why access to water is ahe...
A: Water is a vital resource that is essential for human survival, health, and economy. Access to clean...
Q: DNA evidence
A: DNA = Deoxyribonucleic Acid .
Q: Which of the following statement is correct? a. In insertion mutation, an organic compound insert i...
A: Alternation of DNA sequence takes place in mutation which results in change in genotype and phenotyp...
Q: widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her brother both have a ...
A: Introduction:- A Punnett square is a representation of how different gametes combine to produce dis...
Q: A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data pr...
A: Phylogenetic tree / evolutionary tree is tree that evaluates the relationship of various taxa with e...
Q: bioinformatics help scientists understand the diversity of proteins?
A: Solution : Bioinformatics uses computer programs for a variety of applications, including determinin...
Q: List three general uses for industrial fermentation ethanol.
A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...
Q: 94. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA polymeras...
A: DNA polymerase is typically used in the DNA replication process. Beta DNA polymerase is a subtype t...
Q: What is the key concept for this section? What isHIPPCO? What is the greatest threat to wild species...
A: Ecology is the study of how living organisms, such as people, interact with their surroundings. Huma...
Q: Explain how fog forms off the San Francisco coast. For a complete answer, you need to use the follow...
A: The term fog is associated with the cloud that is comparatively closed to ground than to the sky. Fo...
Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the...
A: Solution : correct option is C
Q: Do all cells contain DNA? Explain your answer.
A:
Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...
A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...
Q: 3. How can one use a pedigree chart to hypothesise how a certain condition is transmitted? Can a ped...
A: Pedigree shows relationship between family members and indicates which individual have certain genet...
Q: Are all vertebrate animals capable of producing a concentrated urine like you are? Why or why not?
A: No Though vertebrates produce wastes that are qualitatively similar to those produced by higher inve...
Q: Tabulate the results of your two-point threshold experiment and produce the homunculus.
A: Answer
Q: Patients, who have a defect in one of the DNA repair systems may have what? Check All That Apply A....
A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA rep...
Q: What happens if the body's cellular respiration system malfunctions? Explain your answer
A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...
Q: Can someone please explain the distinction of natural selection and evolution of populations?
A: Answer
Q: Unlike most examples of this trait, the height characteristic that Mendel studied in pea plants exhi...
A: Mendel's experiment Mendel studied the seven contrasting characteristics of pea plants. These traits...
Q: The Calvin cycle in CAM photosynthesis occurs in O bundle sheath cells. O xylem cells. O mesophyll c...
A: The calvin cycle in CAM photosynthesis occurs in mesophyll cells
Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху In human, each cell has how many chromosomes...
A: The cell division is the process that involves breakdown of the mother cell and produce two or more ...
Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?
A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: Define natural capital. Define natural resourcesand ecosystem services, and give two examples ofeach...
A: "ANSWER Natural capital refers to natural assets that provide natural resource inputs and environm...
Q: Question: Discuss the significance of doing water bacteriology on drinking water from the community.
A: Q. Discuss the significance of doing water bacteriology on drinking water from the community. A...
Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...
A: Humans are either left-brained or right-brained, according to this notion, implying that one half of...
Q: Liverworts were given their name based on this flat, lobed leaf-like structure
A: Liverworts is a flowerless spore producing plant. English word 'wort ' means "small plant " . The t...
Q: Describe one medical/ethical issue that was raised in your lifetime involving politics. How was poli...
A: In light of the recent pandemic that has created shockwaves globally, disruptions pertaining to the ...
Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify t...
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each o...
Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...
A: The left and right hemispheres of the brain process different types of inputs. The left hemisphere p...
Q: The enzyme trypsin is sold as a dietary supplement.What happens to trypsin taken with food
A: Introduction Enzymes act as catalysts that helps in speeding up a chemical reaction.
Q: Check All That Apply As exposure to X-rays increased, the ratio of type 1 to type 2 outcomes increas...
A: 1. What results did muller obtained? ANSWER: The explanation for the aforesaid experiment is given b...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: Epistasis occurs when the expression of one gene is influenced by the activation of one or more gene...
Q: A molecule that donates electrons becomes____ , and the one that accepts the electrons becomes_____ ...
A: Redox reaction consist oxidation and reduction reaction. Photosynthesis is an excellent example of r...
Q: State the role of carbon fixation in photosynthesis
A: To define carbon fixation, we must first define fixation. Fixation, in general, refers to the proces...
Q: 1. In guinea pigs, black coat color (B) is dominant over white (b), and short hair length (H) is dom...
A: Allele - Alternate pair of a gene present on a specific locus/ site on homologous chromosomes. Domin...
Q: What is the life cycle of sea lampreys, and the various control methods for lampreys intersect with...
A: Lamprey or Petromyzon which is commonly known as jawless fish . Lamprey is parasitic in nature use t...
Q: What are two important points that are required for both host and viral DNA replication?
A: Viruses lack cell machinery. Since viruses lack their cell machinery, they completely depend upon th...
Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...
A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...
Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...
A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...
Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: Fluid in the lymph system mostly comes from what leaks out of capillaries O True O False Animals wit...
A: The lymphatic system is another circulatory system present in the body. The composition of the lymph...
Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...
A: The study of what makes a certain action in a specific scenario the proper thing to do is known as e...
Q: Beginning physics students are often taught the basicconcepts of thermodynamics with two phrases: Fi...
A: Introduction A thermodynamic system is a body of matter and/or radiation that is separated from its ...
Q: The electrochemical gradient across the plasma membrane Group of answer choices is caused by more s...
A: sodium concentration is more in outside the cell than the inside of the cell. Sodium potassium ...
Q: On which sex is the frontonasal angle sharp and angular?
A: The answer to this question is B. i.e. females. They have the frontonasal angle sharp and angular. H...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The CDC released the following data in its 2013 Vital Statistics report. Age interval Number dying in age interval Number surviving at beginning of age interval 0-10 756 100,000 11-20 292 99,244 21-30 390 98,953 31-40 1,234 98,164 41-50 2,457 96,311 51-60 5,564 94,352 61-70 10,479 38,788 Table 45.3 Calculate the mortality rate for each age interval, and describe the trends in adult and childhood mortality per 100,000 births in the United States in 2013.com/courses/23575/quizzes/111387/take My Cabrillo 101 Chem101 Preface - Chemistry... JupyterLab O reptile O vertebrate Question 49 49. What happens to a population as it approaches the carrying capacity? O Fewer new individuals are added with each generation O The birth rate increases O The carrying capacity increases O The death rate exceeds the birth rate Question 50 50. Mark and recapture allows researchers to estimate the number of individua O recapture must be done 2 days after the release of the first captured individuals O you must capture and mark all animals in the population O you must capture and ma ksome of the animals in the population3 oBook References Classify each of the following descriptions by its effect on human population growth rates. Low death rate compared to birth rate First phase of demographic transition A population close to its carrying capacity Low birth rate Outbreak of deadly infectious diseases High mortality rate Second phase of demographic transition Current conditions in India Low population growth High population growth
- False False False True 500 drag and drop answer here Here is a chart representing the human population growth on earth. drag and drop answer here 1000 Year (A.D.) Use the data in the chart to classify each statement as true or false. drag and drop answer here 1500 drag and drop answer here 2000 ITEM BANK: Move to Top According to the chart, human population has always been rising. In the year 1500, there were more than 2 billion people on earth. Saying that, "the recent rise in population is due to better farming" is an observation_ Saying that, the recent rise in population is due to better medicine" is an inference. Ecosystem Dynamic HB 6A 2) Limiting FactoWhat are the two key concepts for this section? Listthree variables that affect the growth and decline ofhuman populations. How can we calculate the population change of an area? Define the total fertilityrate (TFR). How has the global TFR changed since1955? Summarize the story of population growth inthe United States. List six changes in lifestyles thathave taken place in the United States during the 20thcentury, leading to a rise in per capita resource use.The life table below is for a species of lizard. Use it to answer the questions below. It can be copied and pasted in excel or downloaded here. What is the intrinsic rate of increase of this population? nx bx 678 1 102 31 3 19 10 4 14 12 5 12 12 6 10 14 7 10 10 8 8 11 9 7 10 1.89 0.053 O 1.32 0.51
- Which of the following questions is most appropriate to an investigation at the population level? 8888 What is the relationship between resource availability and birthrate? What is the effect of diminished resources on an individual's life span? How long does it take for carbon to be cycled from the atmosphere into living tissue? What factors influence the distribution of tropical forests?Visit the website of the Population Reference Bureau, www.prb.org (Links to an external site.). Find the most recent “World Population Data Sheet” under the Data section. Choose two nations to compare with respect to: birth rate, death rate, infant mortality rate, rate of population growth, and/or other data indicators of interest to you. What do these data tell you about the health of the populations of these countries?The Arizona Forest occupies 87,174,334,009 sq. miles land that cater different kinds of species. One of which were the leopards. As of 2019, the total population of leopards is 26,753. Due to severe changes of the environment, there is an average of 571 leopard’s dies while only 255 were given birth each year. In 1950, their population is 63% higher from the current population. Calculate for: Crude death rate Select one: a. 0.04% b. 0.01 % c. 0.03% d. 0.02%
- Visit the website of the Population Reference Bureau, www.prb.org (Links to an external site.). Find the most recent “World Population Data Sheet” under the Data section. Choose two nations to compare with respect to: birth rate, death rate, infant mortality rate, rate of population growth, and/or other data indicators of interest to you. What do these data tell you about the health of the populations of these countries? Add the sources you usedContext Calculating mortality in a very small population: ⚫ 896 people in a population at mid-year • 27 deaths in the population in that year • 247 cases of diabetes in the population • 10 deaths from cancer, 8 deaths from heart disease, 5 deaths from diabetes, 2 deaths from car accidents, 2 deaths from other injuries. ⚫ Of the 896 people in the population, 234 were college students, and there were 2 deaths in that sub-population. Assignment Referring to the data above, please answer the following questions. Answers should be expressed per 1000 people, except for proportionate mortality and case-fatality, which should be expressed as a percent. Round your answers to nearest whole number. D Question 1 important information. A 1 APR 11 O pts Ը 1During a one-year period, a population of rabbits has a birth rate of 0.8 and a death rate of 0.1. The rabbit population consists of 50 organisms (at the beginning of the year). Which of the following is true about the rabbit population during this one-1 year period? O The rabbit population would increased by 35 rabbits during this year. O The rabbit population would decrease by 35 rabbits during this year O There would be a total of 500 rabbits at the end of the year 500 rabbits were born during the year.