The following is the only intron sequence of a gene that will be excised during the maturation of the MRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCA

The following is the only intron sequence of a gene that will be excised during the maturation of the MRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCA

Name: The following is the only intron sequence of a gene that will be exci
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in sometissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this s

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect on the polypeptide chain of factor IX would this new stop codon have?
transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements Splicing of mRNA does not involve any proteins. Answer Bank Splicing occurs while the mRNA is attached to the spliceosome. In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements Splicing occurs after the mRNA enters the cytoplasm but before it binds to the ribosome.
There are a number of conserved sequences found in an mRNA that dictate where splicing occurs. Where are these sequences found relative to the exon-intron junctions? What is the significance of these sequences in the splicing process? One of these important regions is the branch point A found in the intron. What is the role of the branch point A in the splicing process, and can this be accomplished with the OH group on either the 2′ or the 3′ carbon?
Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substrate
B) The beta chain of eukaryotic protein is made up of 141 amino acids. What is the minimum number of nucleotides for the mRNA coding for this polypeptide?
MRNAs and eukaryotic cells receive different modifications than those in prokaryotic cells, because eukaryotic mRNAs must be able to accomplish different things. Which of the following describes events that are necessary for an mRNA to be expressed in a eukaryotic cell, but are not necessary for mRNAs in a prokaryotic cell? select all that apply A) introns must be removed from the eukaryotic mRNA B) The mRNA must leave from the nucleus C) transcription factors must bind to the mRNA in a eukaryotic cell after it is transcribed D) A ribsome must bind to the mRNA .
Explain how the information in mRNA is converted into a fully folded protein, and how the misfolding of proteins can result in disease, giving an example of such a condition. please expain indded with example
What are the “protein synthesis factories?” Give an overview of the relationship between these “factories” and mRNA to explain why they are called the “protein synthesis factories.
A diagram of a gene is shown below. Normally, exons 1, 2, and 3 are present in the mature mRNA. (shown in attatched image) A mutation occurred at the 5’ splice site of exon 1 as shown by the star such that the spliceosome cannot bind to this location during mRNA processing of the pre-mRNA into the mature mRNA. Which of the following is/are a possible result of this mutation? (select all that apply) a)The pre-mRNA transcribed from this gene sequence will be longer than normal. b)The protein translated from this mRNA will be a different length than the normal protein. c)The mature mRNA will be longer. d)The mature mRNA will be shorter.
Provide one mechanism by which changes in mRNA levels are not always matched by changes in the protein product of that mRNA.
"The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic? mRNA Option 1: [Exon 1a][Exon 2][Exon 3].... mRNA Option 2:[Exon1b][Exon2][Exon 3] mRNA Option 3: [Exon1c][Exon2][Exon 3]