Task: Compute n! In this part of the assignment, you will write a recursive function that, when given a number, will print the factorial of that number. When the program is executed, it will ask the user to enter a number, and it will store it a variable: n. This is done for you in the code we have provided at the bottom of the program (between the twO ### DO NOT MODIFY #N comments). Below the # YOUR CODE HERE comment, you will write a recursive function called factorial which has a single parameter (n) and which returns n (i.e., n factorial). Your function must be recursive.

Task: Compute n! In this part of the assignment, you will write a recursive function that, when given a number, will print the factorial of that number. When the program is executed, it will ask the user to enter a number, and it will store it a variable: n. This is done for you in the code we have provided at the bottom of the program (between the twO ### DO NOT MODIFY #N comments). Below the # YOUR CODE HERE comment, you will write a recursive function called factorial which has a single parameter (n) and which returns n (i.e., n factorial). Your function must be recursive.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

python question: Write a code that takes a sentence as an argument and places its words in a list of words in alphabetical order If the sentence is: "Am I good" The function returns: ['Am', 'I', 'good']
Recursive Power MethodWrite a method called powCal that uses recursion to raise a number to a power. The method should accept two arguments: The first argument is the exponent and the second argument is the number to be raised (example” powCal(10,2) means 210). Assume that the exponent is a nonnegative integer. Demonstrate the method in a program called Recursive (This means that you need to write a program that has at least two methods: main and powCal. The powCal method is where you implement the requirements above and the main method is where you make a method call to demonstrate how your powCal method work).
Problem Description: The bird of paradise called the Helipixsal is renowned for its magnificent tail feathers which range in number from five to nine ornate feathers each of a different length. Their "magnificence" is quantified by the rather simple process of counting the exact number of tail feathers and multiplying this by the difference in the length of the minimum and maximum lengths of tail feather. You are to write a simple program that will allow the user to enter the length of each tail feather individually and keep on entering feathers until a -1 is entered. The program will then return the quantified "magnificence" factor.
Complete the Funnyville High School registration program where user is prompted for her full name and the program generates email id and temporary password. Sample run: generate_EmailID: This function takes two arguments: the user’s first name and last name and creates and returns the email id as a string by using these rules: The email id is all lower case. email id is of the form “last.first@fhs.edu”. e.g. For "John Doe" it will be "doe.john@fhs.edu". See sample runs above. generate_Password: This function takes two arguments: the user’s first name and last name and generates and returns a temporary password as a string by using these rules. Assume that user's first and last names have at least 2 letters. The temporary password starts with the first 2 letters of the first name, made lower case. followed by a number which is the sum of the lengths of the first and last name (For example this number will be 7 for "John Doe" since length of "John" is 4 and length of "Doe" is…
Write VBA CODE FOR THE FOLLOWING PROBLEM Problem: The Worksheet named Grades contains a place for students to record the grades they have received in their classes. Students put the number of each letter grade received in the B column. (For example, the worksheet currently shows that the student has taken 9 classes and made five As, one B, one C, one D, and one F as grades. You need to write a program that reads the grades from the worksheet and uses a function to calculate the student’s GPA. For this problem you can assume that all classes are worth the same number of credit hours. The function should send back the GPA to the calling procedure. The procedure will then put up a message box that gives the student their GPA and a message about their GPA, all in one message box. The message should be “You qualify for an internship” if the student has a GPA of at least 3.0. It should be “You’re in the danger zone” if the GPA is between 2.0 and 3.0. And it should be “You are on…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
In C write a grading program as follows.- Ask the user for the number of students and store it in an integer variable.- Create an array of floats with four rows and columns equal to the number of students storedearlier.- Initialize the array to zeros.Create a menu with the following options (use a do-while loop and repeatedly display the menu):A or a to add student info one student at a timeT or t to display class average for homeworkS or s to display class average for quizzesB or b to display class average for examsZ or z to exit program (program repeats until this exit command is entered)
Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.
Python, use function Write a program that provides simple math problems to quizzes a student's ability to perform addition and multiplication.Your program has the additional requirements The program shalldisplay a menu where the user can select the type of problems they want. For example 1) Addition problems only 2) Multiplication problems only 3) Random addition & multiplication problems 4)Exit program The program shalldisplay two randomnumbers from0 to 100 The program shall present the user with 10 questions of the type they selected.The problems will be formatted and presented to the user After the 10 problems are answered, the program shall displaythe number of questions answered correctly and the score as a percentage The program shall return to the menu after summary has been displayed.
Х3: inlTol0 Write a function in Java that implements the following logic: Given a number n, return true if n is in the range 1..10, inclusive. Unless "outsideMode" is true, in which case return true if the number is less or equal to 1, or greater or equal to 10. Your Answer: 1 public boolean in1To10(int n, boolean outsideMode) 2 { 3 } H N M
Question 6 # This function checks whether a given number is even or not def isEven(number): """ what it takes? a number what it does? determines if a number is even what it returns? if even, return 1 if odd, return -1 """ # your code goes in here defisEven(number): #check if the number is divisible by 2 by checking the remainder. if number % 2==0: #If remainder is 0, then its divisble by 2 and an even number #hence return-1 return1 else: #if remainder is not 0, it'll be 1, so its NOT divisible by 2 and its an odd number #hence return -1 return-1 Test case for question 6 try: if isEven(5) == -1: score['question 6'] = 'pass' else: score['question 6'] = 'fail' except: score['question 6'] = 'fail' isEven(5)