(Subject - Development Biology) 1. It is a chemical substances causing developmental abnormalities in the organism? 2. Its a visible rings produced from repeated DNA replication without separation of the newly formed stands? 3. What hormones responsible for molting in insects?

Q: The 72-hr Chick Embryo Whole Mount (SEE IMAGE) Again, before mounting your slide on the microscope…

A: In the 72 hour embryo, area opaca and area pellucida can not be seen Size of the extra embryonic…

Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…

A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…

Q: Section: Mutation and Genetic Change Read the passage below. Then answer the questions that follow.…

A: Introduction Multicellular eukaryotes are the organisms which contains more than one (“multi”)…

Q: Developmental Biology Questio: List two similarites and two differences between the cells on the…

A: The study of the development of a new life from a single cell to a fully matured embryo is known as…

Q: What is the purpose of cleavage during embryonic development? To allow the embryo to get larger To…

A: Cleavage is act of splitting or dividing of cell. Cells divide without increase in mass.

Q: Unicellular organisms like yeast can reproduce asexually via budding. Asexual reproduction results…

A: Budding in yeast : Yeast can reproduce asexually via budding. Asexual reproduction results in each…

Q: 6. How, specifically, can the BCR-ABL protein be inhibited, and what causes this inhibition to…

A: Anticancer medications inhibit cell reproduction and may not prevent cancer cells from spreading.…

Q: Sex is the combining and mixing of _during the formation of offspring. It involves two main…

A: REPRODUCTION:- It is the production of offspring from the parents. It is of two types:- 1)Asexual…

Q: 50 um Figure 3. Grasshopper testis with differential staining and viewed under a microscope.…

A: Meiosis is a type of reductional cell division consisting of two consecutive stages- Meiosis-I and…

Q: Match the statement with the correct reproduction method. * Asexual Reproduction Sexual Reproduction…

A: Reproduction is a fundamental process that occurs in all living organisms. In this process, an…

Q: Which statement about human reproduction is correct? In humans, spermatogenesis and oogenesis both…

A: Human reproductionIn human reproduction, male and female gametes formation occurs. The process in…

Q: The diagram below illustrates the release of chemical A from a human cell in response to a specific…

A: Human cell release chemical -A, this may be hormone, mey be enzyme or may be protein factor. This…

Q: BASIS OF COMPARISON SEXUAL ASEXUAL REPRODUCTION REPRODUCTION 1. No. of parents Two One 2. Unit of…

A:

Q: A large number of sperm cells are produced by males every day. This large number of sperm cells…

A: Sperm cells released into the vagina swim to the opening in the cervix, enters the uterus, and then…

Q: 109

A: Mitosis and meiosis are the two kinds of cell division. Once we say "cell division," they usually…

Q: Specify the molecule involved in each category (e.g. ECM: collagen, CAMs: cadherins, Cell junctions:…

A: Extracellular matrix ECM are a group of secretary proteins that are involved in holding the…

Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Name some derivatives of the neural What is the lamina terminalis

A: Q1. Neural Crest: Neural crest cells are a type of transitory cell that arises from the embryonic…

Q: Based on the results, which conclusion is correct?   A. In sea urchins, only the fate of the…

A: Introduction: 'Sea urchins' also known as 'sea hedgehogs', are small, spiny, globular animals that…

Q: Explain your answer for 1 to 2 paragraphs While many of us have an intuitive sense of the what is…

A: Introduction: The progressive increase in the size of a child or components of a child is known as…

Q: Which of the following statements is not true? O Mutations are only passed down if the mutation…

A: A mutation is a permanent change in an organism's genome's DNA sequence. It can be a single…

Q: Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: |…

A: Q. Frameshift mutation: A frameshift mutation is a genetic mutation that occurs when a deletion or…

Q: Genetics Question 3

A: The SRD5A2 gene provides instructions for making an enzyme called 5-alpha reductase 2. This enzyme…

Q: Humans are 2n=46 in terms of their chromosomes per somatic and germ cell. Knowing the chromosome…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Which round of cell division is uneven? (hint: the SEM images will be helpful) a)First b)Second…

A: During early development, sea urchins exhibit radial holoblastic cleavage.

Q: The two categories of stem cells in the human body are embryonic stem cells and adult stem cells.…

A: All the the answer choices are correct.

Q: Just the Highlights Stages of Prenatal Development The approximately 9-month period between…

A: The prenatal period begins with the mating of a male and a female gamete and includes three stages…

Q: I would like to receive help just to check that i labeled correctly

A: To label the parts of the animal cell.

Q: I need help with a biology question: If gametes have 10 chromosomes, the cell resulting from…

A: Introduction :- Fertilization refers to the union of a haploid male gamete (spermatozoa) with an…

Q: In eusocial insect societies, explain why sterile workers spend their lives (Hello, providing for…

A:

Q: Make a table to identify male and female homologues and describe it common function. Minimum of 7…

A: Introduction : When two organs from different organisms have the same function but are otherwise…

Q: When conducting the eggshell membrane experiment, what is vinegar used for? Multiple Choice   To…

A: Eggshell membrane experiment is an interesting reaction.

Q: The cells bellow are in the process and stages as indicated. Each cell has a 2n # of 6. In the cells…

A: The nucleus of the cell divides into two daughter nuclei that are similar to one another and have…

Q: Name 2 specific proteins you might expect the enzymes released by the acrosome to breakdown. What…

A: Fertilization involves the fusion of the egg and the sperm and is aided by the action of different…