Review I Constants I Periodic TablePart AA decapeptide undergoes partial hydrolysis to give peptides whose amino acid compositions are shown. Reaction of the intact decapeptide with Edman's reagent releasesPTH-Gy. What is the sequence of the decapeptide?1. Ala, Trp2. Val, Pro, Asp3. Pro, Val4. Ala, Glu5. Trp, Ala, Arg6. Arg. Gly7. Glu, Ala, Leu8. Met, Pro. Leu, GluSpell out the name of the polypeptide using three letter codes for each amino acid separated with hyphens (for example, Tyr-Lys-Trp).SubmitRleauest Answer

Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…

Answered: Spell out the name of the polypeptide…

Spell out the name of the polypeptide using three letter codes for each amino acid separated with hyphens (for example, Tyr-Lys-Trp).

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
nyiaial liio C cysteine stop phenylalanine serine tyrosine A leucine serine stop tryptophan arginine arginine arginine arginine leucine serine stop leucine proline histidine U histidine proline proline proline leucine C A glutamine glutamine asparagine asparagine lysine lysine aspartate aspartate glutamate glutamate leucine leucine isoleucine threonine serine isoleucine threonine serine C A arginine arginine glycine glycine glycine glycine isoleucine threonine A methionine threonine valine alanine valine alanine G A valine alanine valine alanine G What would be the sequence of amino acids based on the codons found on the following MRNA? 5' AUGCCCUAUAGGUGA3' leucine - Histidine - Arginine - Valine - Cysteine-Arginine | O Tyrosine - Glysine - Isoleucine - Serine - Methionine-Stop | O Methionine - Proline - Tyrosine - Arginine-Stop O Methionine - Proline -Proline - Valine-Stop |
In the following polypeptide, which amino acid would be participating in hydrogen bonding with alanine, given this sequence forms an alpha helix? Please write out the full amino acid name, not the abbreviation. Met-Ala-Leu-Glu-Lys-Thr-Leu-Val
There are different tRNAs for each amino acid. What is one major way to differentiate among the tRNAs for each amino acid?
If the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by transcription will be and will specify the amino acid A. UUU, phenylalanine B. AAA, phenylalanine C. AAA, lysine D. TTT, arginine In the given anticodon CCA - UAU - UCG, what is the resulting amino acid sequence? A. glycine-isoleucine-serine B. histidine - serine - tyrosine C. proline - tyrosine - tyrosine D. proline - isoleucine - serine Which sequence of amino acids shows the corresponding polypeptide for DNA Sequence 3' AAGGCCGCA-5'? A. phenylalanine - arginine - arginine B. phenylalanine - alanine-alanine C. lysine - alanine - alanine D. lysine -arginine - arginine
How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…
Given the messenger RNA sequence, determine the amino acid sequence of a peptide.
Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?