Specimen Trail 1 Trail 2 Trail 3 Trail 4 Trail 5 Parent 1 Genotype FF Ff Ff Ff Ff Parent 2 Genotype ff ff ff FF FF Offspring 1 Genotype Ff ff ff FF Ff Offspring 2 Genotype Ff ff ff FF FF Offspring 3 Genotype Ff ff Ff Ff FF Offspring 4 Genotype Ff Ff ff FF Ff Offspring 5 Genotype Ff ff Ff FF Ff Ratio of Offspring Genotype O FF: 5Ff: 0 f 0 FF: 1 Ff 0 FF: 2 Ff 4 FF: 1 Ff: 2 FF: 3 Ff 0 f 4 ff 3 ff 5 Black: 0 White 5 Black O White 1 Black: 2 Black: Ratio of Offspring Phenotype 5 Black: 0 White 4 White 3 White

Q: Draw a basket mutant embryo. What does basket encode? Why do the mutant embryos have this phenotype?

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from mistakes in DNA…

Q: At the molecular level, what causes incomplete penetrance? Answer in terms of protein function at a…

A: Incomplete penetrance occurs when in a heterozygote, a dominant allele does not express its trait in…

Q: In a study of a muscle disorder, several affected families exhibited vision problems, muscle…

A: Genes in nuclear content express most of the characters, while some of the characters are associated…

Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22…

A: The above scenario based on linkage and maping.

Q: A XY individuals transcribe the Sxl gene early but not late. B XX individuals carry the Sxl gene, XY…

A: Sex lethal genes Sxl is a gene that is involved in the exression of the X:A signal . It is a…

Q: Describe the differences between a cis-QTL and a trans-QTL. Which type of QTL has the genetics field…

A: In the realm of genetics, quantitative trait loci (QTLs) are genetic variations that influence the…

Q: You sequence a gene in Drosophila melanogaster and D. simulans. You observe 5 non-synonymous…

A: Gene sequencing is used to determine the nucleotide order in a DNA molecule that makes up the…

Q: How can you assess dominance and mapping with only one mutant?

A: Dominant alleles are those which are expressed when present in heterozygous conditions.  The

Q: List the three major classes of segmentation genes and outline the function of each.

A: Segmentation means dividing the embryo into even smaller segments. the specific structures are then…

Q: Robertsonian translocation is  balanced or unbalanced?

A: "Robertsonian translocation" is a type of translocational chromosomal aberration in which…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: What are paralogous and orthologous genes? What are some of the explanations for the finding that…

A: Thus, a gene is a fundamental unit of inheritance, carrying coded information associated with a…

Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…

A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…

Q: 24. 23andme is a direct to consumer genotyping company that uses a microarray to genotype people on…

A: Genetic analysis of one’s genome can give a lot of information about one’s ancestors. Since,…

Q: Give biological term for supressed allele.

A: The presence of two alternative forms/variations is one of the defining features of a single gene…

Q: In c. elegans, genetics model organism, movement problems (unc) and small body size (sma) are…

A: Linkage is defined as the transmission pattern of genes when they are present on the same…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.