Some Events that May Occur during Transcription RNA polymerases detach. DNA polymerases detach. DNA polymerases proofread. RNA double helix is unzipped. DNA double helix is unzipped. DNA double helix forms again. mRNA is built in the 3′ to 5′ direction. mRNA is built in the 5′ to 3′ direction. RNA ligase fuses the Okazaki fragments. RNA polymerase binds to the sense strand. DNA polymerase binds to the sense strand. RNA polymerase binds to the antisense strand. DNA polymerase binds to the antisense strand. Listed in sequence, the events involved in DNA transcription numbered above are Answer, Answer, Answer, Answer and Answer.

Q: Which of the following features is common to both DNA replication and RNA transcription?     Both…

A: Nucleic acids, made up of nucleotide bases, as deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Which of the following DNA repair mechanisms involves the 3’ to 5’ exonuclease function of DNA…

A: Given:   DNA repair mechanisms involves the 3’ to 5’ exonuclease function of DNA polymerase.

Q: If a DNA sequence has 10% guanine, which of the following is TRUE?

A: DNA is a polymer of nucleotide(A, T, G and C) linked to each other via a phosphodiester bond. It is…

Q: What is the function of the Primase enzyme?     To edit out primers at the end of DNA replication…

A: DNA replication: It is a kind of process in which the DNA makes multiple copies of itself during…

Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme Ograbs the incoming…

A: The majority of organisms' genetic material, deoxy ribonucleic acid (DNA), contains nucleotide…

Q: The palm domain of a DNA polymerase contains the catalytic site of the enzy Ograbs the incoming…

A: Introduction Humans and nearly all other species carry their genetic information in DNA…

Q: Statement Replication Transcription The new strand is made 5' to 3'. The new strand is made 3' to…

A:

Q: The MutH protein nicks the newly synthesized strand(Figure 16-23). How does it “know” which strand…

A: DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in…

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens…

A: The Central Dogma of life involves three steps: DNA ==> DNA ==> RNA ==> Proteins The…

Q: DNA polymerases have exonuclease activity that hydrolyzes DNA in the 3′ to 5′ direction. When an…

A: DNA POLYMERASE: DNA polymerase is an enzyme that plays a key role in the replication of DNA, the…

Q: leading strand Primase begins RNA polymerization de novo. lagging strand DNA polymerase synthesizes…

A: The DNA replication starts with some enzymes that cut the strands from one side and attached them…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: What is the function for telomerase, a reverse transcriptase? O to recognize the tip of an existing…

A: The production of new DNA from old DNA is known as DNA replication that occurs within the S-phase of…

Q: The formation of a phosphodiester linkage between the 5'-phosphate group at the end of one DNA…

A: During DNA replication new nucleotides are added to the DNA in the 5' to 3' direction. An incoming…

Q: Which domain of the DNA polymerase has a role on correcting the position of the primer and the…

A: Introduction A domain is a specific physical region or amino acid sequence in a protein that is…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: The RNA polymerase binds DNA template at the promoter region to initiate transcription initiates…

A: Introduction The Key Enzyme Involved In Transcription Is RNA Polymerase. It Creates A Complementary…

Q: Transcription is similar to DNA replication in that ... -RNA molecules are synthesized…

A: Transcription is the process by which information encoded in DNA is copied into RNA. It occurs in…

Q: ing statements about promoters that are true. A promoter specifies where RNA polymerase initiates…

A: Promoter is a specific sequence of dna, where it's length can vary from organism to organism.…

Q: The light blue RNA strand is complementary to which DNA strand in this figure? To which DNA strand…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: DNA footprinting is a technique that can be used to identify: A region of DNA that has been damaged…

A: DNA footprinting is a technique that is used to identify or recognise the interaction between DNA…

Q: What is an advantage and a disadvantage of this repair system?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…

Q: The accuracy of transcription is less than the accuracy of DNA replication. The error rate of…

A: Replication is the process which is responsible for synthesis of DNA from the parental strand of…

Q: Which of the following is correct about transcription?    options:   The reaction is driven…

A: Transcription  It is the process of synthesis of pre mRNA from DNA.

Q: Which of the following is NOT a regulatory DNA sequence? Origin Promoter Repressor

A: A regulatory sequence is defined as a DNA sequence capable enough to affect the expression of…

Q: Which of the following is directly responsible for catalyzing the synthesis of a complimentary…

A: *The answer of this question is option 3 that is Taq polymerase. *Taq polymerase isolated from…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…

A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: function of DNA polymerase I is to?  Add nucleotides to the 3' end of the primer   Add nucleotides…

A: RNA polymerase 1 possesses four enzymatic activities: a 5'-3' DNA dependent DNA polymerase activity,…

Q: Which of the following is/are required for RNA synthesis? (sel

A: RNA synthesis is made from the DNA molecule. so RNA synthesis is the synthesis of RNA like mRNA from…

Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.