Q: Upon what principle does bactofugation depend? Why might its use be desirable in processing milk…
A: Bactofugation is a centrifugal method for eliminating microbe spores from milk, particularly when…
Q: Match the letter to the appropriate bone. Im A d Im
A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…
Q: (a). What is the role of calcium ions and troponin during contraction in striated muscles of hum
A: Introduction - Myofibrils, which contain a specialised protein (myoglobin) and chemicals to deliver…
Q: Which of the following is a correct representation of a segment of DNA? 1. 5'ATTC3' 4. 'ATAG3'…
A: A DNA segment has two strands - coding strand and non coding strand. Coding strand is represented in…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Definition of Synapse: The specialized junction at which a neuron communicates with a target cell…
Q: Which suspect is the perpetrator of this crime? Explain the results you see in the DNA gel. Why each…
A: From the PCR analysis it is found that the two TH0 allele of both the DNA from CS and DNA from…
Q: This process happens in the thylakoids. " O Light Reaction O Calvin Cycle O Both Light Reaction and…
A: Ans: Thylakoid is an membrane bound structure found in chloroplast and cyanobacteria. It is arranged…
Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…
A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…
Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 10° to 10-7…
A:
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: Total eradication of disease through immunization is only possible if humans are the sole vectors of…
A: ANSWER) TRUE By the process of immunization the immunity against the disease can be developed in the…
Q: Large caliber arteries during systole stretch and return to the baseline during diastole, ensuring…
A: Arteries are blood vessels with thick walls to withstand blood pressure.
Q: Which of the following represents an accurate pathway of energy transfer through trophic levels of…
A: Energy transfer In the trophic levels the energy transfers from the producers to the consumers. In a…
Q: In corn plants, the allele for purple kernel (P) is dominant over the allele for yellow…
A: Given - Allele for purple kernel - P Allele for yellow kernel - p Allele for smooth kernel - S…
Q: The bacterium Clostridium difficile (sometimes abbreviated C. diff) is a gut bacterium that can…
A: The clostridium bacterium is found in colon which is the reason of many colon or digestive tract…
Q: Bioassay with Spirogyra and bacteria, pigments, photosynthetics T. W. Engelmann (1882) filament of…
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: Fruit flies infected by fungi are protected by drosomycin and when infected by bacteria are…
A: Drosomycin is a peptide against the fungus infectant when it infact the Drosophila melanogaster or…
Q: A 30 year old female who moved to the U.S. from Thailand 25 years ago has just suffered from an…
A: Answer :- Option (C) is correct. - Aging.
Q: Question 53 Protists (Kingdom Protista) can be: O none of the choices are correct O autotrophic O…
A: We will answer the first question as question number that needs to be solved is not mentioned.…
Q: A heart microslide demonstrates cells in the shape of pale chords, wh have few myofibrilla, glycogen…
A: The heart is a muscular organ that is essential for pumping blood and supplying nutrients, and…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Neural crest cells give rise to melanocytes, smooth muscles cranial cartilage, facial cartilage and…
Q: How does temperature and PH affect the activity of enzymes.
A: Introduction Enzymes function as catalysts. Proteins are the most common, although some RNA…
Q: Cite 3 scientists who made great contributions in the discovery/study of photosynthesis. Explain…
A: Introduction Photosynthesis:- It is a process by which plants use sunlight, water, and carbon…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Introduction Muscles are a type of soft tissue. muscles are made up of a lot of flexible fibres.
Q: principle of a plant virus that transmits through an animal vector
A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: Trypsin digestion of the peptide sequence M3-E4-R5-P6-F7-Hg-Ag-10-A11-R12-T13-Y14- G15-P16 results…
A:
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…
A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…
Q: Members of some species will sound warning calls when they notice predators even though this…
A: In this statement, the individual making alarm noise is not being provided a survival advantage…
Q: How do climate change and extreme weather conditions (i.e. typhoons) affect the water management…
A: Introduction Climate change is already affecting life in Asia. as an example, rising temperatures…
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
Q: Question z Methanogens are always engaged in relationships with other microbes because methane…
A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…
Q: Summarize how the virus interacts with the cells in the airway and lungs and is related to disease…
A: ICTV announced severe acute respiratory syndrome coronavirus 2 SARS-CoV-2 as the name of the new…
Q: SARS-CoV-2 spike engagement of ACE2 primes S2' site cleavage and fusion initiation
A: The SARS-CoV-2 virus's spike (S) glycoprotein is a class I fusion protein which covers the viral…
Q: 5. What causes allele frequencies to differ between biological populations?
A: Allele frequency refers to the how common and Allele is present in a population It is determined by…
Q: Viruses cannot reproduce on their own, without the help of a living cell. Explain the basics of how…
A: A virus is an acellular nucleoprotein entity which is able to utilize the synthetic machinery of a…
Q: Write down the levels of ecosystem organization from smallest to largest, next to its' description.…
A: We will answer the first question as the single question is not specified. Please specify the…
Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…
A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…
Q: Please help Why did we use nanoparticles?
A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…
Q: What are some general similarities in how receptive fields are represented by the nervous system?…
A: Receptive field is a region in the sensory periphery within which stimuli can influence the…
Q: What cell receptor does adrenaline reach
A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…
Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…
A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: When the body fails to carry out the normal metabolic functions due to rare genetic conditions it…
Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…
A: Population density can be calculated by three different methods they are arithmetic, physiological…
Q: 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose…
A: DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…
Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…
A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…
Q: Observation
A: The monosomies , trisomies and other type of chromosomal abnormalities mainly affects the chromosome…
Q: , differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase…
A: It is an enzyme which is produced by salivary glands and it have seen hydrolysis and digestion of…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
please explain
SARS-CoV-2 spreads through cell-to-cell transmission
Step by step
Solved in 2 steps
- Trace the HBV multiplication cycle, paying particular attention to localization within the host cell during the biosynthetic stage.MCQ --Rotarix is a vaccine indicated for the prevention of Rotavirus gastroenteritis caused by G1 and non-G1 types (G3, G4, and G9). Which of the following is NOT correct regards this vaccine? following immunisation, children may become irritable and experience diarrhoea ill infants or who born with SCID should not be immunized is live-attenuated vaccine derived from the G1P[8] rotavirus strain is prepared for IV administration is given in two doses None of the aboveUsing PEN and PAPER ONLY, illustrate a SARS-CoV-2 virion. Label the ssRNA and the 4 structuralproteins. Indicate (write) the structural protein that has significant gene mutations in the Omicronvariant and that make the virus more contagious.
- Using PEN and PAPER ONLY, illustrate a SARS-CoV-2 virion. Label the ssRNA and the 4 structuralproteins. Indicate (write) the structural protein that has significant gene mutations in the Omicronvariant and that make the virus more contagious. Please draw it and label.Illustrate a SARS-CoV-2 virion. Label the ssRNA and the 4 structural proteins. Indicate (write) the structural protein that has significant gene mutations in the Omicron variant and that make the virus more contagious.What are the most encouraging words and messages to tell a newly diagnosed COVID-positive patient? And how to make your colleagues and other health workers feel better when inflicted with the virus?