Pls help ASAP. 1. Which condition is NOT a condition for an equilibrium system?a. equal rates for opposing changesb. a closed systemreactants in the same phased. constant temperatureall of the aboveс.е.

Equilibrium is a condition when no exchange of reactants or products occurs or the two reverse…

Answered: s NOT a condition for an equilibr

Science

Chemistry

s NOT a condition for an equilibr

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Related questions

Q: What does sterically hindered means? How do i identify it given a chemical figure? Please show…

Q: (b) Draw the open, Fischer and Haworth Structures of glucose Q 03 (а) How hydrolysis of cellulose…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: help please answer in text form with proper workings and explanation for each and every part and…

A: Part 2: Explanation:Step 1: Understand the experiment.The experiment measured the activity of…

Q: What amino acid substitution would be accompanied by the largest decrease in enteric water penalty?…

A: Amino acid along with ionizing sie chain ,such as asp, glu, His, liz, impart important properties to…

Q: Draw the structures of the products formed by hydrolysis of the following tripeptide at…

A: For the given tripeptide Gln-Val-Ser (glutamine-valine-serine) hydrolyzed at physiological pH, the…

Q: Please answer all questions. Give virrect structures for the substrate(s) and give the reaction…

A: Here we have to synthesize the given target compound 1-bromoethylbenzene from ethyl chloride in…

Q: Consider the tripeptide phenylalanylcysteylmethionine. Part: 0/2 Part 1 of 2 Draw the structure of…

A: Peptide structures are written in such a way that left side is N-terminal while right side is…

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Which of the structures below corresponds to the dipeptide cysteylananine? The parentamino acids are…

A: Amino acids contain carboxylic acid and an amine functional group on the same carbon atom. Amino…

Q: Using alanine as an example, draw possible conformations of alanine in a peptide chain (Ala-Met-Thr)…

Q: 8. The following proteins represent a wide range of molecular weights and isoelectric points. Mr is…

Q: How many stigma bonds are in CH3CH2CH2SH?

A: Given, The structural formula = CH3CH2CH2SH The compound name of the structural formula CH3CH2CH2SH…

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: A polypeptide is ... O None of the above. O an addition polymer of amino acids O a part of nucleic…

Q: 46. The phosphodiester linkages in DNA and in RNA are, respectively: a. 2' to 3', 3' to 2' b. 2' to…

A: DNA and RNA are nucleic acids. In both phosphodiester linkage is present .

Q: Identify an amino acid that complies with the following characteristic: (Write the COMPLETE name)…

A: Amino acids are molecules that combine together to form proteins. These are a group of molecules…

Q: draw the dipeptides of Thr-Ala and circle the peptide linkage

A: We have to draw the dipeptides of Thr-Ala and circle the peptide linkage

Q: Classify the following as a lipid, carbohydrate, or amino acid: (EOCQ 58) CH,OC(CH,)1,CH, а.…

A: We are authorized to answer three subparts at a time, since you have not mentioned which part you…

Q: How many fused rings are there in steriod?

Q: 6. You are designing a protein, which needs to be stable at high temperatures. Which amino acids…

A: Amino acids are the monomeric units that are used in the synthesis of protein molecules. There are…

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

Q: The below molecule of mannose is the [Select ] anomer. A glucose molecules used to my cellulose…

A: Beta glucose( group on 1 ,6 position are on same side) see in below attached figure. is the monomer…

Q: Fill in the side chains (including stereochemistry) on the dipeptide backbone below to make the…

A: All the amino acids exhibit L-stereochemistry except glycine.

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription. 38. DNA helicase…

Q: 2N N H H NH NH O

A: Given is organic compound.The name of given compound is Macimorelin.

Q: Use the following pentapeptide (5 amino acids linked together) structure and draw it again with the…

Q: НОНН С. H,N-C-C-N-C-C-OH НОСН CH;CHCH, HOH H O TITT I H,N-C-C-N-C-C-OH d. H.NCH.CH.CH.СHН H

A: Amino acids are building blocks of proteins. they're concerned with many chemical and biological…

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: Can you please draw me two versions of the dipeptide tyr-phe that represent the two resonance forms…

Q: Draw the structure of the dipeptide Lys-Pro that is predominant at pH 8. Include all of the atoms…

A: To draw the structure of a dipeptide Lys-Pro that is predominate at pH equals to 8.

Q: Glycogen is a branched-chain polymer of α-D-glucose units in which the chain is formed by C1—C4…

A: Polysaccharides contains large number of monosaccharide units joined together through glycosidic…

Q: C) NUCLEIC ACID Sketch the general structure of a nucleic acid monomer and name all characteristic…

A: Since , you have posted question with multiple sub-parts , we will solve first three sub-parts for…

Q: primarily using 2. A protein is a polymer of amino acids that assume a unique structure in space…

A: To circle and describe the key IMFs in the given protein structure:

Q: Discuss the potential impact of polymorphism on the physicochemical properties of drugs.

A: The potential impact of polymorphism on the physicochemical properties of drugs are

Question

100%

Pls help ASAP.

1. Which condition is NOT a condition for an equilibrium system?
a. equal rates for opposing changes
b. a closed system
reactants in the same phase
d. constant temperature
all of the above
с.
е.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1Equilibrium

VIEW

Step 2 Heterogeneous equilibrium

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

A circular double-stranded DNA molecule contains 4200 base pairs. In solu- tion the molecule is in a B-form helix, with about 10.5 base pairs per turn. The DNA circle has 12 superhelical turns. What is its superhelix density o?
Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different sugarsin its sugar–phosphate backbone, but RNA only has one.(b) Thymine is one of the DNA bases, whereas RNA’s correspondingbase is thymine minus a methyl group. (c) TheRNA sugar–phosphate backbone contains fewer oxygenatoms than DNA’s backbone. (d) DNA forms double helicesbut RNA cannot.
Provide the structure of atactic polystyrene. O Interactive 3D display mode Interactive 3D display mode Interactive 3D display mode
3. Classify the following as a lipid, carbohydrate, or amino acid: (EOCQ 58) CH,OC(CH,)12CH, CHOC(CH,),,CH, CH,0C(CH,),CH=CH(CH,),CH, a.
Chemistry 1. how many amino acids is present in myosin (cite your sources) 2. Structure Characteristics/ Description (indicate for e()xample: amino acids number, type of secondary structure present such as alpha-helix or beta-pleated sheets) of myosin (cite your sources)
A1c Select ONE peptide linkage and draw a circle around all of the atoms that would lie in a single plane. H R2 | H H;Ñ. || C. N R, H H R3 H Ilt. O=0
need help with D)Lipid
Cheto
Truel False: you are asked to determine if the statement is TRUE or FALSE. You must write out the w provide the reason WHY the statement is false in the space below the statement. Do not just change Macromolecules within the cytosol interact in the quarternary structures via covalent bonds. I U S X2 x2 B. !!
Identifying and drawing peptide bonds V Draw the structure of serylarginine, a dipeptide made from serine and arginine, as it would appear at physiological pH. Explanation @ Click and drag to start drawing a structure. Check # $ * % MacBook Pro 80 & 0 X A :0 3 C © 2023 McGraw Hill LLC. All Rights Reser
An optically inactive triglyceride V (MW = 680) yielded one mole of myristic acid (14:0) and two moles of myristoleic acid (14:1). Draw the structure of the triglyceride V. Calculate the iodine number of triglyceride V. Draw the product(s) when triglyceride V reacts H2/Ni. i. ii. 111. (Relative atomic mass: C=12, H=1, 0=16, I=127)
Please don't provide handwritten solution...