RNA polymerase (NMP), + n(PP;) n(NTP) As the equation reveals, nucleoside triphosphates (NTPS) serve as substrates for the enzyme, which catalyzes the polymerization of nucleoside monophosphates (NMPS), or nucleotides, into a polynucleotide chain (NMP)n. Nucleo- tides are linked during synthesis by 5' to 3' phosphodiester bonds (see Figure 10.12). The energy released by cleaving the triphosphate precursor into the monophosphate form drives the reaction, and inorganic diphosphates (PP;) are produced.
Q: Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and…
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: Red blood cells are normally circular in shape. Sickle cell anemia is a disorder that affects the…
A: sickle cell anemia is a genetic disorder caused by alternation in genetic sequence .
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Ornithine is structurally similar to lysine except ornithine’s side chain is one methylene group…
A: Ornithine plays important role in urea cycle. Ornithine is structurally similar to lysine except…
Q: When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands…
A: Denaturation is a process by which double stranded DNA splits into single stranded DNA. It use to…
Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…
A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…
Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?
A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino…
A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in…
Q: Pectin, which occurs in plant cell walls, exists in nature as a polymer of D-galacturonic acid…
A: Pectin is a structural polysaccharide that is present in cell walls and intercellular tissues of…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: DNA photolyases convert the energy of light in the nearultraviolet or visible region (300– 500 nm)…
A: Ultraviolet Radiations forms a part of electromagnetic spectrum and are categorised according to…
Q: 5-Bromouracil is a compound that is known to induce point mutations in DNA. 1) Out of A/C/G/T as…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…
A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…
Q: Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals…
A: DNA polymerases are the enzyme that replicates DNA in cells. DNA polymerase can not create new…
Q: In human DNA, 70% of cytosine residues that are followed by guanine (so-called CpG dinucleotides,…
A: DNA methylation is considered a biological process, where methyl groups are added to a DNA molecule…
Q: You are presented with Cytidine 5’ triphosphate and Thymidine 5’ triphosphate. Draw these…
A: The nucleic acid is one of the types of macromolecules that is present in all living organisms. DNA…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…
Q: Staphylococcus nuclease is an enzyme that catalyzes the hydrolysis of DNA.The reaction is catalyzed…
A: Staphylococcal or micrococcal nuclease is a Ca2+-dependent extracellular enzyme that is produced by…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis…
Q: A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…
A: In biology, DNA replication is that the process of forming 2 identical replicas of deoxyribonucleic…
Q: How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design…
A: Sealing is the joining of two DNA (deoxyribonucleic acid) segments under in-vitro conditions. The…
Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…
A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…
Q: Why is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?
A: Human blood possesses sugar in the form of glucose, it is being carried to all cells as a source of…
Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…
A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…
Q: The two sides of the DNA double helix are con cytosine, and guanine). Because of the geo bonds with…
A: The Chargaff's base-pairing rule governs base pairing in DNA (deoxyribonucleic acid). According to…
Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…
A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…
Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’…
A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…
Q: In human DNA, 70% of cytosine residues that are followed by guanine (so-called CpG dinucleotides,…
A: Normal nucleotide sequence of a DNA as contains four nitrogenous bases Adenine, Guanine, Thymine,…
Q: . Some naturally occurring polynucleotide sequences are palindromic; that is, they are…
A: The palindromic sequence is the DNA or RNA sequence that has the same sequence in complementary…
Q: Enediynes are natural products with potent antitumor properties because they are able to cleave DNA…
A: Enediynes has one double bond and three triple bonds. They perform apoptosis of cells. One…
Q: From this overall anticodon sequence in tRNA,…
A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…
Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…
A: DNA is the genetic material in humans. It carries information that is transferred from one…
Q: pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA…
A: DNA (deoxyribonucleic acid), as well as RNA (ribonucleic acid) both, are the genetic material in the…
Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…
A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…
Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…
A: DNA is a long, double-stranded, helical molecule composed of building blocks called…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: The enzyme creatine kinase catalyzes the ATP-dependent phosphorylation of creatine. Propose a…
A: Introduction: Creatinine is the waste product formed in muscle from a high-energy storage compound…
Q: You are investigating the DNA-binding interaction of the drug candidate below, which binds to DNA…
A: The study of interaction between drug and protein is very important to understand its mechanism of…
Q: Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and…
A: Ethanol is a type of organic chemical. Its formula is CH 3CH 2OH or C 2H 5OH, and it is frequently…
Q: The structure of adenylate cyclase is similar to the structures of some types of DNA polymerases,…
A: adenylate cyclase DNA polymerases Convert ATP to cAMP Adds dNTP to DNA Plays role in signal…
Q: 1. The following synthetic polynucleotide is synthesized and used as a template for peptide…
A: DNA is transcribed to form mRNA. The ribosome sand tRNAs translate the mRNA to form proteins. The…
Q: A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing…
A: Atoms with unstable nuclei regain what is supposed to describe as they are about to define stability…
Q: Using the pKa data in as shown and the Henderson-Hasselbalch equation,calculate the approximate net…
A: pKa is the negative base 10 logarithm of the dissociation constant of an acid in a solution. To the…
Q: Methylated CpG dinucleotides are hotspots for point mutations in human DNA. Can you propose a…
A: Spontaneous deamination of 5 methyl cytosine produce thymine. When its and corrected it causes…
Q: Treating a solution of ribonuclease with 2-mercaptoethanol and urea denatures the enzyme. If the…
A: Introduction 2-mercaptoethanol or also called Beta mercaptoethanol (BE or BME) is a compound (HS -…
Q: Cordycepin (structure shown), a broad-spectrum antibiotic was used to treat a bacterial infection.…
A: Antibiotics are potent medications that fight infections and, when taken correctly, can save lives.…
Q: The function of the histidine residue at the C-terminal end of the beta subunits of hemoglobin…
A: Hemoglobin functions as the oxygen carrier in vertebrates. It is a tetrameric protein, each subunit…
The cleavage the triphosphate precursor into the monophosphate form drives the reaction, and inorganic diphosphates (PPi) are produce, is.....
exogenous or endogenous
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.E Threonine 6. You have identified some intermediates in threonine synthesis: A, B, C, D and E. You grow a few of your mutants in the presence of these different intermediates to determine the order in which the gene products act. Below are your results. A (+) means growth and a (-) means no growth. Given these data, draw the best possible pathway for the synthesis of threonine. The diagram should use arrows to indicate one intermediate being changed to another intermediate. Indicate which gene produces the product responsible for the conversion by listing the mutant in that gene above the arrow. Mt1 Mt2 Mt4 Mt7
- Why is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?Cell wall bullding block D-Ala-D-Alal-Lys-tail NH,Me Heptapeptide backbone R1 R. R2 ii) With the aid of the figure above showing the important features of the binding of Vancomycin (lower part) to a bacterial cell wall peptia discuss the antibiotic effect of Vancomycin. i) Vancomycin resistant strains often have a mutation in which one of the D-Ala moieties is exchanged to a D-lactate moiety. Discuss why this mutation makes the strain Vancomycin- resistant but still viable. iv) Glycoconjugate vaccines based on bacterial capsular polysaccharides have been used for 30 years without any need for changes in their structures, while the flu vaccine, based on attenuated or killed virus particles, requires many different structures and a check each time when there is an epidemic that the right vaccine is used. Discuss the reason behind this.A Leu →Ala mutation at a site buried in the core of the enzyme lysozymeis found to be destabilizing. Explain the observed effect of this mutationon lysozyme stability by predicting how enthalpy (ΔH°), conformationalentropy (ΔS°peptide), and the hydrophobic effect (ΔS°solvent) are expected to change for the mutant compared to wild-type lysozyme. Explain how ΔG°for unfolding is affected by your predicted changes in enthalpy or entropy.
- The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.What is the role of his119 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? RNA -0-CH₂ Q Base His 119 H H NH His 12 -P-0-CH₂ a Base H H 3' H O 2' O-H OH O -0-P=0 It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his12 in order to stabilize the transition state. It serves as a general acid, donating a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his 12 in order to favour the products of the reaction. Two of the above are true.
- 36. How many different amino acids would be found in a polypeptide made from translation of an RNA containing only cytosines (C) and adenines (A) in random order (no Us or Gs at all)? (Use the table in your textbook or other source if you can't see the one provided.) SECOND BASE UUUPhenylalanine (Phe) UAU UCU UGU Tyrosine (Tyr) Cysteine (Cys) u Uuc UUA Leucine (Leu) Uua UCA FSerine (Ser) uca UAC UAA -Stop codon UAG -Stop codon UGA -Stop codon uaa -Tryptophan (Trp) CAU COU cac CGA FArginine (Arg) caa) CU CACHistidine (His) Cuc CUA cua Leucine (Leu) Proline (Pro) CCA cca CAA Glutamine (Gin) CAGF AUU AUC AUA AACAsparagine (Asn) AAA AAGLysine (Lys) AGU ACU ACC ACA Threonine (Thr) ACG AAU Isoleucine (le) AGC Serine (Ser) Methionine (Met) Start codon AGG Arginine (Arg) AUG - GU Guc GUA Gua GcU acC GCA FAlanine (Ala) GAU GACAspartic acid (Asp) GAA Glutamic acid (Glu) Ga. ne (Val) - Glycine (Gly) G Valine GGA six one four four twenty FIRST BASE THIRD BASEOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-35'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG