Predict the function, which is used to count all the rows without the need to check the NULL Values. O a Sumo Ob. Count(") O. Total 0 Od. Count
Q: Allow the user to enter 10 numbers, sort and display the list in ascending and descending order.…
A: Bubble sort C program: #include <stdio.h> #define MAX 100 int main(){ int arr[MAX],limit;…
Q: A = {1, 2, 3} B = {1, 2, 3, 4, 5} C = {1, 2, 4, 5} print(A.issubset(B)) This returns false
A: Python Set issubset(): If all items of a set are present in another set, the issubset() function…
Q: Jsing a professional tool, create an algorithm to explain how you would solve this problem: A…
A: import java.util.Scanner; public class KboatGreatestNumber { public static void main(String…
Q: Sum of two squares def sum_of_two_squares(n): Some positive integers can be expressed as a sum of…
A: Given:- Sum of two squaresdef sum_of_two_squares(n):Some positive integers can be expressed as a sum…
Q: - A Moving to another question will save this response. Question 9 Given the function F(X,Y,Z)=XZ +…
A: In this question, we have to simplify the given function F. Using boolean properties, we can…
Q: Command Line Calculator The program will ask the user to select a function from 1-5 (1-Add,…
A: Create a Scanner object to read user input.Initialize the variable choice to 0.Start a do-while loop…
Q: a and b are int variables containing values and a > b. Write a for loop that computes the sum of…
A: Here no language has been specified. So, the problem has been solved using a c programming language.…
Q: Cyclops numbers def is_cyclops(n): A nonnegative integer is said to be a cyclops number if it…
A: Given: Cyclops numbersdef is_cyclops(n):A nonnegative integer is said to be a cyclops number if it…
Q: CodeWorkout Gym Course Search exercises... Q Search kol X459: Review Fibonacci In mathematics, the…
A: Given: To write a recursive function that returns nth fibonacci number:
Q: A for-loop can have multiple index values. O O
A: A loop is the sequence of the instructions that can be repeated continuously until the condition is…
Q: % WRITE CODE BELOW: % Step 1: Write a function called "collatz" below where you take an input % n,…
A: Here is the matlab code of the problem. See below steps for code and output.
Q: get_nth_word_from_string(s, n): This function takes a string s and a non-negative integer n as…
A: def get_nth_word_from_string(s, n): # function to get the nth word from string index = 0…
Q: Write a program that allows the user to enter the last names of a number of candidates in a local…
A: There is no programming language mentioned, so i have used C++ for program. Please check the step…
Q: X275: Recursion Programming Exercise: Check Palindrome Write a recursive function named…
A: Palindrome: A word or phrase that reads the same backward as forward.
Q: in Python: Write a program that removes all digits from the given input. Ex: If the input is:…
A: Input : String Output : Remove digits from string
Q: def longest_chain (lst: List[int]) -> int: Given a list of integers, return the length of the…
A: Please refer to the following steps for the complete solution to the problem above.
Q: To use math.sqrt function you need to first: O def math O import math O Do nothing
A: Sqrt function is used to find the square root of a number.
Q: function main() { # ist: input numbers #w: outer for loop index # X: inner for loop index # y:…
A: Filling blanks in given code function main() {# ist: input numbers #w: outer for loop index# X:…
Q: The statement (J • J) ⊃ S has ______ unique statement letter(s). Therefore, its truth table…
A: Solution: Given, The statement (J • J) ⊃ S has ______ unique statement letter(s). Therefore, its…
Q: Please Use PYTHON def count_scrabble_points(user_input): """ The function ... """…
A: I have provided PYTHON CODE along with CODE SCREENSHOT and OUTPUT…
Q: Alert dont submit AI generated answer. (Central city) Given a set of cities, the central city is…
A: Since you are not mentioning the programming language, here we are using Java to complete the…
Q: Function Name: dominosTime() Parameters: N/A Returns: None Description: During the summer, you…
A: Python used to answer this question
Q: Complete the following sentence. There are two basic forms of loop constructs: while loops and…
A: The problem is based on the types of loops in programming languages.
Q: The voting resuts trom he student bady representative race has been reportad by cach faculty as…
A: Required:
Q: Write a program that prompts the user to assign an integer value for A, B, and C then use the switch…
A: PROGRAMMING LANGUAGE USED : C++ Step 1 : Start Step 2 : Taking user input for the number A , B and…
Q: The following function has errors. Locate as many errors as you can. void area(int length = 30, int…
A: Correction Explanation: The argument length should be declared inside the function body or at the…
Q: Function ConvertHoursToMinutes(integer totalHours) returns integer totalMinutes totalMinutes =…
A: 1. Start the program.2. Define the function ConvertHoursToMinutes that takes an integer totalHours…
Q: You are asked to write a small division calculator, where you are taking 'a' as dividend and…
A: The above question is solved in step 2 :-
Q: 7. Iteration 3 is shown. Draw iteration 0, and 4. ten
A: In each iteration, the cell is divided to 2 in the next level. The Iteration 0 will be:
Q: Exercise: Enter the number of rows: 5 1- Write a program that shows the following output: 123 12345…
A: C is a procedural language. Patterns in C are shape like structures of characters printed row by row…
Q: tile_dict = { 'A': 1, 'B': 3, 'C': 3, 'D': 2, 'E': 1, 'F': 4, 'G': 2, 'H': 4, 'I': 1, 'J': 8,…
A: I have provided PYTHON CODE along with CODE SCREENSHOT and OUTPUT…
Q: . Number Sorter in Matlab Requirements: ● Must be a console program ● Reads integers…
A: The MATLAB code is given below with output screenshot
Q: Requirements: ● Must be a console program ● Reads integers from standard input (i.e from the…
A: Please find the answer below :
Q: Complete the code for this recursive function. def fib(n): if n == 1: return 0 if n == 2: return 1…
A: Introduction: - Here is asking to complete the code, that will need to fill in the two blank that…
Q: Topics: User-defined functions, list, string, docstring Problem Statement: This program finds the…
A: 1) Below is program to finds the unique letters from a given string and prints the unique letters…
Q: True or False Individual variables are well suited for storing and processing lists of data.
A: Explanation: Every variable is an individual item which should be declared and assigned…
Q: The following functions are all intended to check whether a string representing a dna sequence…
A: The following functions are all intended to check whether a string representing a dna sequence…
Step by step
Solved in 2 steps
- Command Line Calculator The program will ask the user to select a function from 1-5 (1-Add, 2-Subtract, 3-Multiply, 4- Divide, 5-Exit the program). Afterwards, the program asks for two inputs from the user and prints out the result of the two numbers given which operation the user selected. After printing the result, loop back to asking the user to select a function again until he enters 5 to exit the program. Try to complete this task using methods for each function and using loops. Please use IF and ELSE COMMAND.C++ Coding: Nested Loops Create a constant DIM. Set DIM to 7, and use a nested loop to display the following square matrix output. Output Example: - - - X - - -- - - X - - -- - - X - - -X X X O X X X- - - X - - -- - - X - - -- - - X - - -C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- 10. Exercise 9 - Strings (Assessed Exercise) Important: Do not attempt this exercise before completing Exercises 6, 7 and 8. Think how to reuse the functions you created in Exercises 6, 7 and 8. Design and Problem Solving: Create an algorithm for a program that reads a string with a maximum length of N from the keyboard (N should be specified by the user). N should not be more than 100. The algorithm should then copy the characters from that input string into a second character array (in the order of input). However, a character will be copied into the second array only if it is a vowel (i.e., a, e, i, o, u). This second array should be allocated dynamically and its size will depend on the number of characters that will be copied into it. Murdoch UNIVERSITY Once copied, the algorithm should output the values stored in the second string. The algorithm should then count and display the number of times each vowel appears in the second array. Also, the algorithm should determine and output…True or false: setInterval() executes a function repeatedly until the interval is cleared by clearInterval() using the ID returned by setInterval(). О а. True O b. FalseC Programming Write function checkHorizontal to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square to the left or right is a space, stop checking d. If the square to the left or right is the same character as the player’s character, save that it was a flank, stop checking e. If the square to the left or right is not the same character as the player’s character, count the disc f. If the counted discs is greater than zero AND the player found their own character, return the counted discs, otherwise return ZERO Write function checkVertical to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square above or below is a space, stop checking d. If the square above or below is…
- function avg and pass x and y Tin printf ("the avg of x and y is %d\n', avgl) give_sqrt (avgl); return 0, float avg (float m, float n) I/ Return the average of n and m void give sqrt (float x) printf ('the sqrt of is Mn'x :/ Print the sqrt value of x. return;In this lab, you will: Use input() to read line Use for loop to go over all symbols in the line Use created a dictionary to get the corresponding value for a certain key Instructions Scrabble is a word game in which words are constructed from letter tiles, each letter tile containing a point value. The value of a word is the sum of each tile's points added to any points provided by the word's placement on the game board. Write a program using the given dictionary of letters (keys) and point (values) that takes a word as input and outputs the base total value of the word (before being put onto a board). Implement function create_scrabble to calculate the total points for the given string (the function's parameter) and return the value for the word. Outside the function, print the total value for the word. Ex: If the input is: PYTHON the output is: 14 def create_scrabble (user_input): tile_dict = { 'A': 1, 'B': 3, 'C': 3, 'D': 2, 'E': 1, 'F': 4, 'G': 2, 'H': 4, 'I': 1, 'J': 8,…PYTHON QUESTION ASSIGNMENT REQUIREMENTS This assignment requires a dictionary of state abbreviations and their capital cities. The abbreviations are the keys and the state capitals are the values. Start by entering data for any four states of your choice. Then, report this count but use a function to get the count. Use a while loop to add more abbreviations and capitals. The loop should continue until the user presses Enter when prompted for an abbreviation. Inside the while loop: If the state entered is already in the dictionary, report its capital. If it is not in the dictionary, prompt the user to enter the capital for that state and add it to the dictionary After the while loop ends: Report again the count of the number of states in the dictionary. Using another loop and the items() method, display all the state abbreviations and their capitals. In the same Python program write this code, although it has nothing to do with the states code. Using a dictionary…
- 2- The factorial n! of a positive integer n is defined as n! = 1*2*3 . .. * (n-1) * n Where 0! = 1 Write a function to calculate the factorial of a number. Argument: A number n of type unsigned int. Returns: The factorial n! of type long double. Write two versions of the function, where the factorial is • calculated using a loop calculated recursively Test both functions by outputting the factorials of the numbers 0 to 20.Develop simple PL/SQL programs a) Create a while loop that print all ODD numbers (1,3,5,7, etc) in the range from 5 to 25. b) Find a sum of all these numbers, print the sum only once at the end.