ОН 9. CH OH 1 H ОН Complete the following reaction by drawing the molecular structure of the main product. Label the reactants and products. Circle and label an example of the hydroxyl functional group in the reactants. Circle and label the main type of linkage present in the product. H о ОН х-о-б OH + ОН CH₂OH -o-r 5-o-x Н ОН Н О 3-0- ОН ОН

Q: 18. Distinguish among the functions of the primary motor cortex, premotor area, and prefrontal area.

A: Brain is the vital organ  that help to maintain and regulate the basic activity of humans. The motor…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: watch the four minute video: https://www.youtube.com/watch?v=B-nEYsyRlYo  Anwer this question:What…

A: It is very important to value life and not only our life but also the life of other living beings.

Q: In the chief complaint, it states that the patient had dyspnea after climbing one flight.Explain…

A: INTRODUCTION Dyspnea Dyspnea is shortage in breathing after doing hard workout or climbing altitude.…

Q: 41. The nurse is reviewing the prescriptions for her patients. The nurse should contact the provider…

A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…

Q: Name please_

A: 1) Metzenbaum-Nelson curved scissors 2) Doyen's curved scissors  3) Curved artery forceps

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: What is professionalism?

A: Nursing is profession of medical healthcare wherein they provide care and support to the ill persons…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: 1. How do the central nervous system and peripheral nervous system differ from each other?

A: The central and peripheral nervous systems are the two components of the nervous system in animals.

Q: Aphakia and it's correction

A: Eye- The eye is one of the sense organs of the body which is used for seeing different objects. The…

Q: you did not provided the whole worksheet

A: Asexual reproduction involves only a single parent while sexual reproduction involves two parents as…

Q: Is it possible to get this typed

A: Introduction Antibiotics are the compounds that are used specifically to target and kill bacteria or…

Q: Styles Editing 50% of the offsprings will be hornless Hh and 50% of the offsprings will be horned hh…

A: Given information: Genotype of red raddish- RR Genotype of white raddish-WW Genotype of purple…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: If a prime mover muscle such as the pectoralis major is surgically removed, how will the actions…

A: Pectoralis major is a muscle located at the chest of the body of humans. It is a fan-shaped thick…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Amylase is an enzyme that breaks down carbohydrates. What is the biological significance for the…

A: Amylase is an enzyme that acts as a catalyst in the hydrolysis of starch into sugar. They act on the…

Q: Name 4 pieces of equipment found in the PACU cubicle

A: PACU is an abbreviation for Post Anesthetic Care unit. PACU is a specific unit in the hospital,…

Q: TERM MAIN ENTRY (Pronunciation) MEANING (Definition)

A: Term Main Entry Meaning Aphasia uh-fay-zee-uh Inability to understand or produce speech, as a…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: Question: The patient complained of pyrosis after heavy meals. Define this term?

A: Introduction: The digestive system comprises various organs that aid in the digestion of food and…

Q: 1. How muscles and joints work together

A: muscles are connected to bones by fibrous bands known as tendons. these provide stability and allow…

Q: What is  hypoventilation

A: Ventilation is a process of exchange or movement of air (gas) between the lungs and atmosphere…

Q: d. What is the specificity of this test? T 1.

A: There are four types of result:1. True positive: Positive in both screening and diagnostic tests.2.…

Q: TEKS 7.11B 1 The term one organism has from others of the same species. describes the difference in…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: QUESTION 5 While tetanus is the term we use to describe summation of twitches, it is also a disease…

A: Tetanus is a disease caused by the bacteria called Clostridium tetani. This disease is also known as…

Q: 7nm= _ um= _ mm

A: 1 nano meter is equal to 0.001 or 1/1000 micrometer 1 micrometer is equal to 0.001 or 1/1000 milli…

Q: 21. What happens to sodium channels and potassium channels đuring repolarization of a neuron? A.…

A: There are two divisions of the nervous system. The central nervous system includes the brain and the…

Q: Can you do the first part

A:

Q: PS 21 2

A: Step 1 Every cell has the power to grow and divide to form new cells of the same kind. At the time…

Q: A- Min

A: Muscles of forearm, wrist and hand are subdivided into 19 intrinsic and 24 extrinsic muscles. The…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Q: List the important ideas in the video.

A: An organism's genome is defined as all of the genetic information that is passed down from…