Occurring in the nucleus ribosomemitochondrion, translationtranscription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amino acids is called translationtranscription. In the cytoplasm, the nucleus ribosomemitochondrion reads the amino acid sequence and assembles the protein. Question 18MINIXProteinsProteins are determined by the structure of DNA and RNA. DNA consists of two chains of nucleotides held together by chemical bonds. Base pairing rules determine how the bases of each chainwill bond to one another. RNA also has repeating nucleotides, bases that are held together by chemical bonds, and specific base pairing rules, but it is a single strand and has different bases thanDNA. The sequence of DNA is rewritten into an RNA copy which then determines the sequence of amino acids of a polypeptide chain, the primary structure of a protein. A single amino acid isadded to the protein strand for every 3 bases, or codons, in the RNA. The sequence of amino acids determines the way the protein will fold. The folding of the protein determines its function. Thestructure of DNA, RNA, and a protein are shown.DNAFirst nucleotideUUUUUUCUUAUUGCUUCUCCUACUGThe triplet codon used to decipher the amino acids is mostly universal. Each amino acid has more than one codon. Methionine (AUG) is the initiation codon that starts the translation process.There are 3 codons that stop the translation process.AUUAUCAUAAUGRNAGUUGUCGUAGUGU(Phe)LeuLeu)lle(Met)ProteinValUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSecond nucleotideсSerPauseProThrAlaFoldedproteinQ ZoomCAUCACCAACAGUAUTyrUACUAA STOPUAG STOPAAUAACAAAAAGGAUGACGAAGAGAHisGlnAsnLysAspGluUGUUGCCysUGA STOPUGG TrpCGUCGCCGACGGAGUAGCAGAAGGGGGUGGCGGAGGG(Arg)SerArgGlyUט » U כ ט » U כ ט » U כ ט » U כсAAAThird nucleotideUse the drop-down menus to complete the statements that describe protein synthesis.Occurring in themRNA sequence is converted into a sequence of amino acids is calledprotein.Q Review/✔ Finish Testis the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which thereads the amino acid sequence and assembles theIn the cytoplasm, the

Name: Occurring in the nucleus ribosomemitochondrion, translationtranscr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Occurring in the nucleus ribosomemitochondrion, translationtranscription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amin