Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what ways could the presence of an Alu sequence affect a nearby gene?
Q: Is the sequence of amino acids in rubisco encoded by nuclear genes or not? Explain.
A: The enzyme rubisco stands for ribulose bisphosphate carboxylase/oxygenase. It acts as a key enzyme…
Q: What is a gene? Why are genes for rRNA and tRNA considered to be genes even though they do not…
A: Structurally, RNA (RNA), is kind of like sugar Nucleic Acid(DNA). However, whereas polymer molecules…
Q: What would happen evolutionarily if DNA was transmitted precisely from generation to generation…
A: Mutations are inheritable alteration in DNA sequence. It can occurs in single base pair or long…
Q: in general, how does the location and abundance of regulatory DNA sequences change with increasing…
A: Introduction A genome is an organism's complete set of genetic instructions, It consists of…
Q: In a genomic analysis looking for a specific disease gene, one candidate gene was found to have a…
A: Point mutations are of several kinds deletion inversion substitution duplication The single base…
Q: which DNA sequences are commonly found at human centromeric regions?
A: The cell biology is considered as the study of cells, their structure, and their functions. The…
Q: Since we have known the sequence of the human genome for almost two decades, why sure of the total…
A: Because it is difficult to tell where one gene ends and another begins . Another difficulty is same…
Q: a) What dipeptide is produced from the following segment of DNA: AGAGAT? (b) What happens to the…
A: Gene expression is the process in which information stored in the DNA is converted into the…
Q: If you assume the average length of a DNA linker region is 50 bp,approximately how many nucleosomes…
A: The eukaryotic chromosome is made of half DNA and half proteins, from proteins, one half is the…
Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…
Q: (a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is…
A: The genetic code comprises the set of rules that tells how the four nucleotide bases in the DNA are…
Q: Researchers sometimes use gamma rays to induce deletion mutations in certain organisms and thus…
A: Question - Researchers sometimes use gamma rays to induce deletion mutations in certain organisms…
Q: How many different dna fragments would you expect to obtain if you cleaved human genomic dna with…
A: The cell is the fundamental unit of life. The nucleus part of the cell contains Deoxyribonucleic…
Q: What is meant by the idea that genes are “immor
A: A gene is the basic physical and functional unit of heredity.Genes are made of DNA.Some genes act as…
Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…
A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…
Q: You have isolated a transposable element from the human genome and have determined its DNA…
A: Transposable element also known as jumping gene, is a DNA sequence which can change its position in…
Q: The A+T:G+C ratios in DNA of cattle and rat are very similar. Would you expect the +RNAs, rRNAs,…
A: Gene expression refers to the highly regulated complex biological mechanism involving the…
Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…
A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…
Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…
A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…
Q: A geneticist is trying to determine how many genes are found in a 300,000-bp region of DNA. Analysis…
A: Deoxyribonucleic acid (DNA) is the genetic material. Nucleosome is the packaging unit in eukaryotes.…
Q: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total…
A: The mitochondrial DNA (deoxyribonucleic acid) is 16.6 kilobase pair long that contains 37 genes. It…
Q: Why do you think all the information in the DNA of all living organisms would be coded by only 4…
A:
Q: Since COVID19 RNA is able to replicate exponentially in human cells without being detected…
A: Covid is a disease caused by corona virus. This is a epidemiological disease.
Q: If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe…
A: Step 1 The transposable element is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: How do we know if a genomic DNA sequence contains aprotein-coding gene?
A: Only about 1% of DNA contains protein-coding genes; the remaining 99 percent is noncoding. Noncoding…
Q: The following are DNA sequences from two homologous genes:…
A: Homology is an idea of finding evolutionary lineage. Homology is deduced when two Deoxyribose…
Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…
A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…
Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…
A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…
Q: Why would a mutation in a somatic cell of a multicellular organism not necessarily result in a…
A: Eukaryotic organisms have two types of cells: germ cells which produces gametes and somatic cells…
Q: If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one…
A: Hemophilia is a hereditary problem that causes interior and outer draining by keeping blood from…
Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…
A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…
Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…
A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…
Q: In a genomic analysis looking for a specific disease gene,one candidate gene was found to have a…
A: The discovery, measurement, or comparison of genomic properties such as DNA sequence, structural…
Q: In addition to correcting DNA mismatches, themismatch repair system functions to prevent…
A: Mutations are usually defined that they are supped to refer to changes or alterations that occur in…
Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…
A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…
Q: The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in…
A: In the mammalian genome, DNA methylation is an epigenetic mechanism involving the transfer of a…
Q: What are the amino acids encoded by gene Z?
A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…
Q: If most of the DNA in Bacteria and Archaea is coding DNA and much of the DNA in higher plants and…
A: Bacteria have various shapes which ranges from spheres to rods and spirals.Bacteria are among the…
Q: The following image depicts a short stretch of sequence associated with a gene. Which of the…
A: The given DNA strand is as follow 5'- AACTATAAGCCTTGGCCGATTCGATGCTAAATTGCGCATAA-3 We know DNA has…
Q: Three human genomic DNA fragments (A, B, and C) are sequenced and revealed the following: fragment A…
A: DNA or Deoxyribonucleic acid is the genetic material that is found in most higher organisms. It is a…
Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…
A: Central Dogma of Biology: The flow of genetic information from DNA to RNA which is…
Q: What is a nucleosome-free region? Where are such regions typically found in a genome? How are…
A: Given: Explain about the nucleosome-free region. and explain such regions typically found in a…
Q: how does the location and abundance of regulatory DNA sequences change with increasing organism…
A: Promoters, enhancers, and silencers are the three main types of regulatory sequences.
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: In order to make a plant gene sequence functional when added to a bacterial genome, what kinds of…
A: Gene structure is the organization of specialized sequence elements within the gene. Genes contain…
Q: (a) Is it biologically advantageous that DNAis stable? Why or why not? (b) Is it biologically…
A: The two major types of nucleic acids are DNA and RNA. They are made from nucleotides, containing a…
Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what ways could the presence of an Alu sequence affect a nearby gene?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?
- Using a laser beam, you isolated several R bands from human chromosomes. Answer the following questions What kinds of genes are present in R bands? Which isochors do you expect to be present in the R band? What class of interspersed repeats will be present in R bands? What class of tandem repeats do you expect to find in RG bands? Would you expect to find telomere sequences in some R bands?You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and diverge more slowly than the genes that encode them.What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?
- Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…
- Huntington’s disease is a hereditary central nervous system disorder characterized by tandem repeats of the sequence 5'-CAG-3' in the gene that encodes a protein called huntingtin. The disease is progressive from generation to generation, meaning that in later generations the number of CAG repeats increases and the age of onset of symptoms decreases. Refer to Figure 21.4 and describe the sort of evidence supporting the generational increase in the number of CAG repeats.At the end of the short arm of human chromosome 16 (16p), several genes associated with disease are present, including thalassemia and polycystic kidney disease. When that region of chromosome 16 was sequenced, gene-coding regions were found to be very close to the telomere-associated sequences. Could there be a possible link between the location of these genes and the presence of the telomere-associated sequences? What further information concerning the disease genes would be useful in your analysis?A geneticist is trying to determine how many genes are found in a 300,000-bp region of DNA. Analysis shows that four different areas within the 300,000-bp region have H3K4me3 modifications. What might their presence suggest about the number of genes located there?