lotu PREDICT THE FINAL SEQUENCE OF REACTIONSSIL A) H-CEC-H n Navita B) H-CC-H 2) Mez 3) R2BH 4112021 NaOH 1) NaNz 2) Me D 3) NaNH2 4)6+2 5) Na, NH3 (1) 4.
Q: In which of the following alkenes will a hydride shift occur upon adding HCI ? a. 0 O b. c. d. e.…
A: All the alkene structures shown (a, b, c, and d) are simple non-cyclic alkenes without any…
Q: 1. Propose a synthesis for the transformation below. O Ph O Sol-80 CH₂OH
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: is Fe2+(aq) + 2OH−(aq) → Fe(OH)2 (s) an oxidation reduction reaction
A: No, the reaction Fe2+(aq) + 2OH−(aq) → Fe(OH)2 (s) is not an oxidation-reduction reaction. In an…
Q: None
A: Step 1:KOH is a base and potassium 2-chloropropanoate is the salt, so, in this problem we actually…
Q: Prepare the compound by using suitable reagents. More than one step will likely be required.
A: To synthesize cyclohexylpropan-2-ol from malonic ester, we can use a multistep process involving…
Q: Highlight each peptide bond in the molecule below. In addition, list the common names of the smaller…
A: In chemistry, a peptide bond is known as a type of bond that typically forms in amino acid-amino…
Q: For this question: How SPF blocks UV Rays from the sun Please try to answer it in a presentation…
A: Ultraviolet (UV) radiation is a type of electromagnetic radiation that is produced by the sun.…
Q: I need help solving the mass of solution (g) and density of sugar solution A (g/ml)
A: Volume of water, mL10.00Mass of Erlenmeyer flask, g31.030Volume solution delivered to the flask,…
Q: Write down the Lewis dot structures of each of the following molecules. Check the formal charge in…
A: Now let's draw the Lewis dot structure for each molecule givena) CH2Cl2 In this Lewis structure,…
Q: how many grams of CuSO4 are needed to prepare. mL of a 0.200 M solution
A: The formula to calculate the amount of solute needed is given by:Moles of solute=Molarity ×…
Q: Answer asap
A: a. Description of the Method for Determining the Rate of PhotosynthesisThe botanist can determine…
Q: 1. Use resonance structures to explain why this is not the correct conformation of an ester Me
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: 68. In the presence of NH 3, Cu+2 forms the complex ion Cu(NH3) 4+2. If the equilibrium…
A: Step 1:Introduction to question :Given ,In the presence of NH3, Cu+2 forms the complex ion…
Q: Which of the following could trans-1,2-diethoxycyclopentane be directly synthesized from? C O HO HO…
A: Step 1: Information: The given question is based on retro synthetic analysis.In the retro synthetic…
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: Draw the reaction mechanism of 4-aminobenzenesulfonic acid with 2-naphthol for the formation of an…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Draw the major product of this aldol addition reaction. Ignore inorganic byproducts. 1. NaOH + 2.…
A: Ans.
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: EXPLAINED ABOVE IN DETAILED
Q: Please answer 26
A: Here we started to count from the right not from left because the substituent should be bonded to…
Q: (c) ? Br OEt OH O
A: Step 1:The diagram represents the reaction of an alcohol (OH) with a strong base (Br) to form an…
Q: Please don't provide handwritten solution.
A: Step 1: The circuit can be redrawn as:Clearly,A||B= 12||25= 12*25/(12+25)= 8.11 ohm which is in…
Q: Be sure to answer all parts. Complete the reactions to show how the following product can be…
A:
Q: Use synthesis to solve this Please Write Step by Step Solution Otherwise i give DISLIKE !!
A: Step 1: Step 2: Step 3: Step 4:
Q: Under acidic conditions (catalytic amount of acid) in anhydrous methanol, D-galactose can be…
A: Step 1: D-Galactose to methyl glucopyranoside reaction:In the given reaction, the monosaccharide has…
Q: Draw D-galactose in the most stable chair conformation by applying H, OH and CH2OH the drawing…
A: The first step is to always draw the chair conformation of glucose which is shown below:Dont mind…
Q: + STARTING AMOUNT X A solid 30.2 cm³ block of KCIO 3 is heated in the laboratory and decomposes…
A: Step 1: First, let's find the mass of the KCIO₃ block:Mass = Density × VolumeMass = 2.34 g/cm³ ×…
Q: A solution is prepared that is initially 0.25M in hypochlorous acid (HCIO) and 0.31M in potassium…
A: Step 1: GivenHypochlorous acid, [HClO] = 0.25 MPotassium hypochlorite, [KClO] = 0.31 MpH = ?Ka of…
Q: How many organic products are there in the reaction of 1,3-cyclohexadiene with HBr? (note: be sure…
A:
Q: 1. Draw the structures of the constitutional isomer of the following molecular formula:a) C8H18b)…
A: 1.a)one constitutional isomer is octane CH3(CH2)6CH3 . This is a straight-chain alkane with 8…
Q: In a titration experiment, 15.0 mL of 0.15 M Ba(OH)2 is required to titrate a 20.0 mL of an unknown…
A: Step 1: First ,Write the balanced chemical equation 2HNO₃ + Ba(OH)₂ → Ba(NO₃)₂ + 2H₂O Determine…
Q: :&;$;$:$$:$$;$;
A: It seems like you're describing a series of reactions involving bromine (Br2) under various…
Q: 18.3.2 Determining Reaction Orders Some useful physical properties: 1. Polarimetry (optical…
A: Dalton's law of partial pressure:Dalton's law of partial pressure states that total pressure of a…
Q: Below is the partial structure of a polyamide polymer. Draw the structures of the two monomers that…
A: In case of any doubt feel free to ask.
Q: Which orbital diagram represents the electron configuration of the low-spin octahedral complex…
A:
Q: 1-Write the structures of all possible enolates for each ketone. Indicate which you expect to be…
A: Step 1: The enolate with the less substituted C=c double bond is obtained by removing a proton from…
Q: 1. Draw a diagram to show how two ethanol molecules can H-bond with the soap molecule. O ||…
A:
Q: Consider the branched alkane below and complete the following tasks based on its structure. Part: 0…
A:
Q: Answer all 3 asap
A: Step 1: When two molecules collide a. Molecules are correctly oriented when they collide. c. The…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R₁ and R₂…
A: Lysine (R) and Glutamate (R):Interaction: Hydrogen bond can form.Reason: The side chain of lysine…
Q: Determine the product(s) formed when cyclohexane is tested with the following reagents.
A: NBS in the presence of DMSO serves as a versatile toolbox for selective bromination and other useful…
Q: 5. Assign R,S configuration to the following molecule. HOOC Br H3C a) H H₂N CH3 NC... b) H c) H…
A: Approach to solving the question:R and S nomenclature is used to define the stereochemical…
Q: dont provide handwriting solution....
A: In diethyl malonate the alpha proton is very acidic and that can easily be abstracted of ethoxide…
Q: Consider the reaction CO(g) + Cl2(g) CoCl2(g) Using the standard thermodynamic data in the tables…
A: standard delta G = delta G of product - delta G of reactant We need to look up the standard Gibbs…
Q: Chemistry
A: Step 1:At first, when no base is added, we have a very low pH because we only have a strong acid.…
Q: Suppose the galvanic cell sketched below is powered by the following reaction: Fe(s)+Pd(NO3)2(aq) →…
A: Step 1: In the galvanic cell, the oxidation and reduction reaction occur simultaneously. At anode =…
Q: 1. Propose a synthesis of alkyl chloride A, using the following alcohol as a starting material.…
A:
Q: The following reaction type is A. Gas evolution B. Single displacement C. Synthesis D. Double…
A: Step 1: MgSO3 + 2HBr -> MgBr2 + H2O + SO2 Step 2: A. It is a reaction in which there is gas…
Q: = Review Homework REQUIRED (NOT Pie Progress) Question 17 of 46 (2 points) | Question Attempt: 1 of…
A: The balanced chemical reaction of acetylene with Oxygen is, 2C2H2 + 5O2 --> 4CO2 + 2H2O To…
Q: Please answer 28
A: Step 1: Step 2: Step 3: Step 4:
Q: 3. Design a synthetic route for the following compound starting from the given reactant. (10 marks)…
A: Detailed synthetic root for above transformation is given below.
Step by step
Solved in 2 steps with 2 images
- X app.101edu.co # 3 E UL Week 7: Panopto DII 0 F3 $ R F4 X UL LTU 7-1A Identify the best conditions to complete the SN2 reaction shown below. H % 5 T N3 گیا QL FS A 6 Y Question 18 of 24 40 X F6 & 7 C|Chegg.com U F7 8 A) CH3I, THF B) NaCN, DMSO C) NaN3, ethylamine D) KI, THF X + E) NaN3, DMF PrtScn FB Home ( 9 F9 O ) End 0 & 3 ENG F10 P PgUp - F11 Tp S <10) 1 PgDn D + 6:16 PM 10/18/2022 F12Answer correctly1 H₂SO4 H₂O Reaction A Select 5 www G Draw Templates More III C OH
- What is the starting material for the following sequence?(Pep) R, H2N (Реp) H R2 H- -Glu131 H2N R2 -Glu131 он он но Zn Tyr246 он Zn Zn Tyr246 H2N, -(Pep) R2 R, (Реp) H2N' -OH H2N R2 FH. он -Glu131 -Glu131 он H. Zn Zn Tyr246 он Тy/246 H20 Zn Zn R, +H2 (Реp) H2N R2 он -Glu131 OH Zn Zn Tyr246 Describe the mechanism shown above for a double zinc aminopeptidase. • Describe the chemistry of each step • How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate. IZAn HDI of 3 is consistent with this structure. O True O False CH₂
- Aspirin can be synthesized from salicylic acid and acetic anhydride in the presence of catalytic H,SO, catalytie H90, d183 gimi. (0.05 mol) according to the reaction saieylie acid CHO MW-13812 amal acetyi chleride CHO. M 100 0 d d1.08 gim anpirie CO, MW 180.1s gmel shown. If 1.0 mol of salicylic acid and 3.0 A) H,SO, mol of acetic anhydride react, which B) salicylic acid is considered the limiting reactant? C) acetic anhydridePlease show me how 5 was formed.shobha
