#include main(){int a, b, c,d;clrscr();printf("enter the two variables a,b");scanf("%d %d",&a,&b);printf("enter the option 1: Addition,2:subtraction, 3: multiplication, 4: division");scanf("%d", &c);switch(c){case 1:da+b;printf("Addition of two no.=%d", d);break;case 2:d = a-b;printf("Subtraction of two no.=%d", d);break;case 3:d = a*b;printf("Multiplication of two no.=%d", d);break;case 4:d = a/b;printf("division of two no.-%d",d);break;}}(a) Draw the DD graph for the program.(b) Calculate the cyclomatic complexity of the program using all four methods.(c) List all independent paths.(d) Design all test cases from independent paths.(e) Derive all du-paths and dc-paths using data flow testing.

To answer the questions about the provided C program, we need to analyze its structure and logic.…

Answered: #include main() { int a, b, c,d;…

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.
def truth_value(integer): """Convert an integer into a truth value.""" # Convert 0 into False and all other integers, # including 1, into True if integer == 0: truth_value = False else: truth_value = True return truth_value Now, write a function that goes in the opposite direction of the truth_value() function. This new function should convert a truth value into an integer. In particular, True should be converted into 1 and False into 0. Name the new function integer_0_or_1(). All you need to include below is your definition of the function integer_0_or_1(). It will be tested automatically against relevant inputs. So include your function and nothing more.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
#include <iostream> #include <cmath> using namespace std; // declare functions void display_menu(); void convert_temp(); double to_celsius(double fahrenheit); double to_fahrenheit(double celsius); int main() { cout << "Convert Temperatures\n\n"; display_menu(); char again = 'y'; while (again == 'y') { convert_temp(); cout << "Convert another temperature? (y/n): "; cin >> again; cout << endl; } cout << "Bye!\n"; } // define functions void display_menu() { cout << "MENU\n" << "1. Fahrenheit to Celsius\n" << "2. Celsius to Fahrenheit\n\n"; } void convert_temp() { int option; cout << "Enter a menu option: "; cin >> option; double f = 0.0; double c = 0.0; switch (option) { case 1: cout << "Enter degrees Fahrenheit: "; cin >> f; c =…
This is the C code I have so far #include <stdio.h> #include <stdlib.h> struct employees { char name[20]; int ssn[9]; int yearBorn, salary; }; // function to read the employee data from the user void readEmployee(struct employees *emp) { printf("Enter name: "); gets(emp->name); printf("Enter ssn: "); for (int i = 0; i < 9; i++) scanf("%d", &emp->ssn[i]); printf("Enter birth year: "); scanf("%d", &emp->yearBorn); printf("Enter salary: "); scanf("%d", &emp->salary); } // function to create a pointer of employee type struct employees *createEmployee() { // creating the pointer struct employees *emp = malloc(sizeof(struct employees)); // function to read the data readEmployee(emp); // returning the data return emp; } // function to print the employee data to console void display(struct employees *e) { printf("%s", e->name); printf(" %d%d%d-%d%d-%d%d%d%d",…
C++ shapes.h: #include <iostream>#include <cmath>struct Point2d{double x;double y;void print(){// example: (2.5,3.64)std::cout << "(" << x << "," << y << ")" << std::endl;}double length() const{return std::sqrt(x * x + y * y);}// const Point2D & ==> function can't modify 'other'// the second const ==> function can't modify x, yPoint2d add(const Point2d &other) const{Point2d result;result.x = x + other.x;result.y = y + other.y;return result;}};// example of an interfacestruct Shape{virtual bool contains(Point2d p) = 0;};struct Circle : Shape{Point2d center;double radius;bool contains(Point2d p){Point2d diff;diff.x = p.x - center.x;diff.y = p.y - center.y;double distToCenter = diff.length();return distToCenter <= radius;}};// TODO: replace this with your Rectangle implementationstruct Rectangle : Shape{// TODO: which member variables to model a rectangle?bool contains(Point2d p){return false; // TODO }};//…
Programming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…
Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace

Recommended textbooks for you

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

C How to Program (8th Edition)

Computer Science

ISBN:

9780133976892

Author:

Paul J. Deitel, Harvey Deitel

Publisher:

PEARSON

Database Systems: Design, Implementation, & Manag…

Computer Science

ISBN:

9781337627900

Author:

Carlos Coronel, Steven Morris

Publisher:

Cengage Learning

Programmable Logic Controllers

Computer Science

ISBN:

9780073373843

Author:

Frank D. Petruzella

Publisher:

McGraw-Hill Education

SEE MORE TEXTBOOKS