I'm very confused on #13. Can anyone explain if the claim is valid or not? I don't understand how to calculate #15. Can someone show the formula for it? #16 I think is C and #17 I think is B. Is this correct?
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: Dr. Kavorkian orders 10.00 g of a medication for your patient. If each tablet contains 200.0 mg of…
A: Conversion of gram into mg 1 gm=1000 mg
Q: You want to set up a 1:10 dilution series, so that you can plate a 10-1, 10-2, and a 10-3dilution;…
A: It is basically done for counting the microorganisms like viruses, bacteria etc from an unknown…
Q: The two most abundant pigments in the chromatography results were carotene and Xanthophyll. What…
A: A photosynthetic pigment is a pigment which is found in green plants and do not absorb all the…
Q: ER 1ZER TIZER GEL
A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…
Q: You receive a prescription to prepare 2.5 pounds of tranexamic acid 6 % (w/w) cream. How much cream…
A:
Q: What are the mechanisms of samples separation work in Thin layer Chromatography?
A: Chromatography is a physicochemical technique for the division of compound mixtures, in view of the…
Q: This master formula is for 24 lozenges! I need this calculate to show the ingredients for 30…
A: Given, The master formula for 24 Diphenhydramine HCl lozenges Diphenhydramine HCl - 0.120 g Acacia…
Q: Metric Prefixes Nano-, Micro-, Centi-, and Milli- Match each prefix with its value. Micro 2 Nano 3…
A:
Q: Which of the following compounds will not discharge the brown/orange color of bromine? (Negative…
A: Bromine test is a qualitative test to detect the presence of unsaturation, phenols or anilines. The…
Q: a. What is the generic name? b. What is the trade name?. c. Is this drug a controlled substance? d.…
A: Dilaudid hydromorphone HCl is a hydrogenated ketone of morphon and comes under opioid analgesics. It…
Q: a. What is the generic name? b. What is the trade name? c. Is this drug a controlled substance? d.…
A: Warfarin is a medication used as anticoagulant which prevents blood clotting in cases like deep in…
Q: BSA Concentration (ug/mL) Abs 2000 2.25 1500 1.715 1000 0.915 750 1.156 500 0.714 250…
A: A standard curve is defined as a calibration curve that is used for quantitative estimations. In…
Q: Dosage equals: mg drug/kg body weight g body weight/g drug g drug/g body weight O kg body weight/mg…
A: mg drug/ kg body weight
Q: Given the graph below, what is the value of Vmax? Numeric answer only, no units needed. 20 18 16 14…
A:
Q: What are the x and y values that you have input in the excel? I thought the x would be from the…
A: Proteins are composed of amino acids, coomassie brilliant blue dye binds to basic amino acids of the…
Q: You want to feed a new flask @: 2 x 105 cells/mL, 8 mL total per flask. Describe how you dilute your…
A: Viable or the live cells can be counted by the instrument called the hemocytometer. These live cells…
Q: Chromatography is not used to separate mixtures. O True O False
A: Introduction There are various biochemical techniques which is used to separate the components of…
Q: If the 10-9 plate was counted to have 155 colonies on it, would the CFU/mL be 1.55*1011? If not,…
A: CFU Colony forming unit it a method to calculate the number of microorganisms in a culture media.
Q: ordered is 2.5 g of Staphcillin. The vial reads: Add 8.6 ml of diluent to contents of vial. Each ml…
A: Penicillins are used to treat bacterial infections. They function by either eradicating the germs or…
Q: Why are food additives used? Classify them and give an example for each one.
A: Food additives are substances that are added to food products to help them perform specific…
Q: lidocaine
A: 2 % lidocaine means 2000 mg / 100ml which is equal to 20 mg/ml. Ordered dose = 100 mg Available dose…
Q: Using 10 μL of a patient's serum, how much diluent would be needed to create a 1:10 dilution? ______…
A: Dilution is the technique of lowering the concentration of a solute in a solution by merely adding…
Q: 7. Short answer. Professor Forni has hired you as a research assistant and you need to make an X-gal…
A: Questions are more than one. Please repost the other questions separately. X-gal staining is central…
Q: When a mixture of various molecular sized dyes are run through a gel chromatography column, what is…
A: Chromatography is a process of separation of substances from mixtures based on their molecular size.…
Q: The doctors order 750mg of amoxicillin for your patient. A 1g vial of powdered amoxicillin is…
A: Order given = 750mg = 0.75g Available stock = 1g vial Reconstitution to be done to form 1g/10mL.…
Q: Column Chromatography Another name for separation in column chromatography is
A: Another name for seperation in coloumn chromatography is Adsorption column chromatography.…
Q: If a pharmacist added each of the following to 22-g packages of 2% mupirocin ointment, what would be…
A: Mupirocin is an antibiotic that prevents bacteria from growing on your skin. Mupirocin topical is…
Q: What volume of 2mg/mL BSA stock is needed to make 40uL of 100ug/mL BSA? Group of answer choices A)…
A: BSA refers to bovine serum albumin in an important constituent is molecular biology experiments.…
Q: What will be the size of the larger product? O 5254 bp O 5192 bp O 5231 bp
A: Base Pairs -- Base pairs describes the relationship between the building blocks on the strands of…
Q: You are observing the results from a standard plate count and you observe 53 CFUS. To make the plate…
A: The correct answer is option (4) 5.3 x 105 CFU/ml CFU/ml stands for colony-forming units per…
Q: What are the essential information that we must include in the manufacturer lebel?
A: Labeling is an important process in the pharmaceutical industry during the supply of the…
Q: Given the chromatogram below, which of the following is the possible identity of unknown sample Y?…
A: chromatography Thin layer Chromatography is a technique to separate non-volatile substances in a…
Q: What is the difference between copay, coinsurance, and deductibles?
A: The inpatient refers to client who is admitted to the hospital for the treatment of his/her illness…
Q: How many chloramphenicol capsules, each containing 250 mg, are needed to provide 25 mg/kg/day for 7…
A: The patient weighing of 200Ibs=9.1kgPrescribed daily dose =25mg/kg/day for 7 days1 capsule=250mgThen…
Q: Milligrams 47.0 milligrams = Multiple Choice O 0.47 decigrams 4.7 centigrams 0.047 grams 0.00047…
A: 47 milligrams or mg quantity of substance is equal to 47 /1000 gram i.e. , it is 0.047 g of…
Q: Fill out the blank of the drug study table
A: Crystalloids are tiny and made of components that form crystals such as NaCl. It allows for simple…
Q: How will you know when the endpoint of the titration is reached? Why is it necessary to mix the…
A: Reaction It is a process in which reactant molecules react to each other and form another molecule…
Q: Why is it important to maintain a constant volume of water in your water bath (when boiling nucleic…
A: Water baths are constant temperature laboratory equipment used to heat samples. The simpleprinciple…
Q: show the complete solution and write answers in 3 significant figures. DYE CALCULATED Rf Tartrazine…
A: Introduction The retention factor (Rf) of a particular compound is the ratio of the distance the…
Q: Eucalyptus essential oil acts as a diuretic. To help lose extra water weight, you can create a blend…
A: Carrier oils are used in conjunction with essential oils to dilute and change the rate of…
Q: A recipe yields 75 servings (4 oz), and you want to adjust it to yield 50 servings (4 oz). One of…
A: Given: A recipie yields 75 servings of 4 oz. Flour in 75 servings = 6 oz We have convert 75…
Q: Which sample shows positive results in benedict's test? why?
A: Introduction: Benedict's test is a simple science test used to recognize reducing sugars.
Q: We have 50 X TAE (Tris-Acetate) stock in our laboratory and the laboratory manager asks you to…
A: TAE buffer is a common buffer used in DNA electrophoresis. It has a pH of 8.0 and is made up of Tris…
Q: What is the driving force behind paper chromatography?
A: Chromatography is a laboratory method of separating the mixture into individual components. It…
Q: 1. The nitrogen base v Would be found at the position labeled #1. 2. The nitrogen base V Would be…
A: Answer : 1. The nitrogen base Thymine would be found at the position labeled #1 Watson Crick pairing…
Q: 11. 24000 bp? A. 8.33 B. 7.39 C. 8.41 D. 7.62 E. None of the above.
A: Gel electrophoresis is a standard molecular biology procedure used for the separation of DNA by its…
Q: For the same chromatographic column and experimental conditions Rs when H = 3 cm = Rs when H = 5 cm…
A: Asked : For same chromatographic column and experiment conditions the answer out of given options is…
I'm very confused on #13. Can anyone explain if the claim is valid or not?
I don't understand how to calculate #15. Can someone show the formula for it?
#16 I think is C and #17 I think is B. Is this correct?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Understanding the Nature of the Ubiquitin-Ubiquitin linkage Draw the structure of the isopeptide bond formed between Gly76of one ubiquitin molecule and Lys48of another ubiquitin molecule.Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.The subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motif
- AsapEffect of DNA Mutations on Protein Structure & Function The structure of a typical human protein coding MRNA including the untranslated regions (UTRS) Cap 5' UTR Coding sequence (CDS) Poly-A tail 3' UTR Start Stop 5' 3' Question 2: Which of the following mutations may affect translation initiation? A. Silent mutation in the coding sequence. B. Missense mutation in the coding sequence C. Deletion of four bases in the 5'-UTR D. Deletion of four bases in the 3'-UTREvidence that each nucleotide is partof only one codon EXPLAIN
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anFrom the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? 5' His 119 RNA CH₂ H H 3 O Base 1' 12' 8-H His 12 -P-0-CH₂ a Base H H O -0-P=O H OH NH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his119 in order to stabilize the transition state. It donates a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his119 in order to favour the products of the reaction. Two of the above are true.
- Because of the way the genetic code structured, a point mutation in a given codon is likely to have what impact on the meaning of that codon? Select all that apply. 1.It will always change the amino acid 2.It can never change the animo acid encoded 3.The amino acid encoded often will not change 4.The biochemical property of the amino acid encoded likely will not change 5.The biochemical property of the amino acid encoded will always changeTRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA otein 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair → rules for RNA! AU TA VERSION 1 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 nucleotide sequences called CODONS. Use the codon chart to find the correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G Cheatham G C oints Fuer DNA TAC ATA A CA GTC стт TAG CT A AT C TAC T GG ACA GGT ACC ATA ACT = activity you mber to deter = may code Fuer MRNA veral thousar ctivity takes on 2). And se AA o pp DNA TA C C G T CcC A GT GT C T G C A A A ACT TAC GACAGC TAC GT G G C T сс ATC Turn in lete all tables MRNA AA n Synthesis mment DNA TAC сТА CT T G T C T T G G C C ACG AT T TAC CAT C C G GA C GG G TAC T TA A T C Class comme to Sea aclass comm MRNA AARNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence for the structure of RNA? Please help simplify/explain this in 5 sentences or less