If myoglobin is found in all chordates, urochordates, and cephalochordates, b-globin is found in all vertebrates, a-globin in all ostracoderm descendants, z-globin in all gnathostomes, e-globin in all viviparous mammals, and g-globin in all placental mammals, then the most ancient of these genes: must be epsilon-globin (e-globin), found only in descendants of the ancestral marsupials must be myoglobin, found only in descendants of the chordates, urochordates, and cephalochordates must be gamma-globin (g-globin), found only in descendants of the ancestral placentals must be zeta-globin (z-globin), found only in descendants of the ancestral gnathostome fishes must be beta-globin (b-globin), found only in descendants of the ancestral vertebrates

Q: Athena Williams was born as a healthy baby girl- and while she was small (25th percentile) the…

A:

Q: Select all that is true of hox genes/proteins 1.They contain the homeobox domain 2.They contain…

A: Hox gene is responsible for determining the general body plan, such as the number of body segments…

Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…

A: The phenotype is the physical appearance or observable trait of an individual genotype. The…

Q: Due to evolutionary forces, the genes of insects and mammals have diverged functionally. True…

A: One of the most exciting aspects of evolutionary biology is the functional divergence of genes…

Q: Can Environmentally Acquired Traits Be Inherited in Mammals?

A: The genetic traits that are encoded by the genome of an organism are transmitted across generations.…

Q: When during the development of most mammals is lactose available for use by E. coli in the gut? How…

A: Each warm blooded creature on the earth is inhabited with Escherichia coli (E. coli) , just as cold…

Q: 67371- Page 5 23) The leg structures of many different vertebrates are quite similar in number and…

A: Evolution is the process of change in living organisms over successive generations. It refers to the…

Q: Explain the likely evolutionary origin of mitochondrial and chloroplast genomes. How have the sizes…

A: Mitochondria also are known as a powerhouse because it helps to release energy from food.…

Q: What is the function of a gene (FOXP2) that is rapidly evolving in the human lineage?

A: The FOXP2 gene is responsible for providing the instructions for making a protein known as forkhead…

Q: What are some of the explanations for the finding that humans are a much more complex organism than…

A: Humans are more complex than roundworms.

Q: Are there any globin pseudogenes in mammals? Explain.

A: Normal genes are made of the sequences of DNA that code for genes, responsible for the synthesis of…

Q: The following system models the exchange of nutrients between mother and fetus in the placenta:…

A: The mechanism below simulates the flow of nutrients between the mother and the fetus in the womb.…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 9. Generate a FULL protein sequence alignment for one of the…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Explain Synpolydactyly caused by mutations in the human HoxD13 gene.

A: Synpolydactyly (SPD) is a rare congenital distal limb malformation, which is characterized by the…

Q: What is different about the C residues in CpG islands compared to C residues in the rest of the…

A: CpG dinucleotides are the short interspersed DNA sequences that are unevenly distributed throughout…

Q: List the three major classes of segmentation genes and outline the function of each.

A: Segmentation means dividing the embryo into even smaller segments. the specific structures are then…

Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…

A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…

Q: In mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: freshwater water fleas (Daphnia) develop without hemoglobin (Hb) and are whitish when living in…

A: With the exception of Leptodora, which can grow up to 18 mm in length, the aquatic organisms in the…

Q: How are the molecular interactions between Hoxd13 and Hoxd11 and Shh and Gli3 in the limb similar?

A: "Hoxd 13 is protein coding gene"  that play's critical role in limb development. If Hoxd 13 has…

Q: MCR1 the only gene responsible for the variation in the human skin color?

A: MCR1 (melanocortin 1 receptor)  gene is very well known to be associated with the variations found…

Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…

A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…

Q: How many number of genes a Mouse (Mus musculus) has ?

A: The study of genomes' design, functioning, development, sequencing, and modification is the core of…

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.