Huntington’s disease is an inherited neurological ailment with a variable age of onset. A protein called huntingtin has a sequence of repeated glutamine residues, all encoded by CAG. The number of repeated CAG triplets is expanded in Huntington’s disease, apparently as the result of replication errors. The age of onset is related to the number of CAG triplets in the repeat region; the more glutamine codons, the earlier the onset. Describe experimental evidence, using Southern blotting, that is consistent with this finding.

Q: * Proteins contain .11 (C) D,L-Amino acids O (D) Both (A) and (B (A) Only L- a- amino acids O (B)…

A: Proteins are made of amino acids. An amino acid contains an amino group, a carboxyl group, a…

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: Briefly describe expanding nucleotide repeats. How do they account for the phenomenon of…

A: Nucleotides are the structural and functional unit of RNA or DNA molecules. It is composed of a…

Q: Explain why all transposons include inverted repeats.

A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…

Q: When an injury occurs to the skin, the epithelial cells near the wound are signaled to react (by…

A: Introduction:- Chromosomes are the most condensed and compact structures that are made up of DNA…

Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Genetic mutations can generate a PTC and elicit NMD in several ways: directly by generating a…

Q: Some DNA nucleotides are located within the coding regions of genes, where they specify the amino…

A: When transcription activator proteins bind to the regulatory promoter sequences of gene, they…

Q: Here is a second human gene, called cxx3. The structure indicates the following: the start and end…

A: RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a molecular technique commonly used to…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…

A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…

Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…

A: Please follow step 2 for detailed explanation.

Q: What causes trinucleotide repeat expansion?

A: Trinucleotide repeat expansion refers to the phenomenon where trinucleotide sequences in certain…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…

Q: Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG.…

A: Given,Original Codon Sequence: AUGACCCGGCUACUGMutant Codon Sequence: AUGACCCGGUUACUGOriginal Protein…

Q: Metabolic syndrome is a genetic disorder with symptoms of hypertension. concentrations, and…

A: Metabolic syndrome is a medical condition characterized by a number of health problems, including…

Q: Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce…

A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: What is the biological significance of the extensive degeneracy of the genetic code?

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: Crick's Central Dogma states that there is a unidirectional flow of genetic information  DNA --->…

A: Central dogma helps in explaining the flow of genetic information inside a biological…

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: Explain exactly what the X25 probe is and how it allows for visualization of mRNA from the patients.…

A: Frataxin is a mitochondrial protein responsible for iron binding. When the expression of this…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…

A: BASIC INFORMATION  GENETIC CODE  The genetic code term was coined by George Gamow. There are total…

Q: What are long terminal repeat (LTR) ?

A: Long terminal repeat are repetitive sequence of DNA found at the end of pro-viral DNA after reverse…

Q: "The process of transcription begins at the start codon which is the nucleotide sequence AUG that…

A: It is one of the first steps in the process of gene expression. The genetic information moves from…

Q: While helix-turn-helix (HTH) is known to be involved in both eukaryotic and prokaryotic…

A: helix-turn-helix (HTH) is a DNA-binding motif found in a variety of proteins, including…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Nonsense mutations occur when a premature nonsense or stop codon is introduced in the DNA sequence.…

Q: Describe the function of telomere repeat-binding factors.

A: Telomeres are the ends of chromosomes. they are made up of short repetitive sequences and prevent…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.