Given in the photo is a family that has a history of phenylketonuria (PKU). Couple 1 Couple 2 PKU heterozygote (carrier) PKU homozygote Answer both: A. What is the mode of inheritance for phenylketonuria? O Autosomal dominant O Autosomal recessive o X-linked dominant O X-linked recessive o Y-linked o 1/4 o 1/2 O 1 Couple 3 B. If couple 1 decides and they are capable of having another child, what is the probability that the child will have PKU?
Q: Phytonadione, also known as Vitamin K1, is required by the body for the modification of certain…
A:
Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…
A: Proteins are one of the major 4 biomolecules, these act as building blocks of biological tissues.…
Q: 8. You have sequenced a segment of DNA from a species in the genus Lithobates (true frogs). The…
A: The regulation of gene expression in a cell to prevent the expression of a specific gene is known as…
Q: Which of the processes does not lead to variation in offspring with the same parents?* A.…
A: variation means any difference between cells or individual organisms of any species caused either by…
Q: The following involves the expelling of dead organelles and/or foreign substances out of the cell: O…
A: Biomolecules migrate around the body, going from one location to another. The molecules can pass…
Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…
A: Nondisjunction:- The event during cell division in which chromosomes do not separate properly. This…
Q: in a diploid species, one somatic cell has8 chromatids before S phase. In this species, 2n=2? 2n=4?…
A: Introduction When people talk about "cell division," they typically mean mitosis, which is the…
Q: In Lassaigne Nitrogen Test, If a substance is positive for nitrogen, what functional groups may the…
A: Lassaigne Nitrogen Test: In elemental analysis, the sodium fusion test, also known as Lassaigne's…
Q: In your opinion, for efficient multiphoton excited fluorescence microscopy, would it be better to…
A: The absorption and subsequent re-radiation of light by organic and inorganic specimens is typically…
Q: Serum blood of a patient with dislipoproteinemia type 1 has milky appearance even in fasting. If…
A: Dyslipoproteinemia is also known as dyslipidemia, which means the abnormal concentration of…
Q: Describe vesicle trafficking process.
A: The cells of our body are made up of many organelles and each one has its specific role to perform.…
Q: The cell senses ATP is not being produced. What immediate effect will this have on the rate of…
A: INTRODUCTION ATP Adenosine triphosphate : source of energy.
Q: In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are nucleic acids and serve as carriers of…
Q: The biogenesis of ribosomes is regulated
A: Ribosomes are cell organelles that lack a membrane or else we can say ribosomes are cell organelles…
Q: The blood brain barrier can be attributed primarily to which cell type? Tight junction between…
A: Introduction : Numerous cells serve as the main component in the efficient functioning of the…
Q: why would a cell invest ATP to move particles using active transport?
A: Materials must be moved against a concentration or electrochemical gradient, which requires the cell…
Q: How does the eye normally adjust to looking at objects at different distances..
A: The process by which certain muscles (called ciliary muscles) function to change the focal length of…
Q: what changes have happened technologically, medically, Culturally and nutritionally that results in…
A: Introduction Human growth is determined by total birth, death, immigration, and emigration.…
Q: How old is the quail in the picture below, according to the wing feathers? 6| 7 Primary # Dropped or…
A: The quail bird can be aged by looking at its primary covert coloration and by looking at the molting…
Q: Explain how phylogenetic trees are interpreted and created. Explain what types of traits are used…
A: Explanation: A phylogenetic tree is a graphical depiction of the evolutionary connections between…
Q: major problem with morphologically based analysi
A: As the name indicates, the morphology-based analysis only considers the visible characteristics of…
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: We know that Female body undergoes various hormonal changes during pregnancy. Hormonal fluctuations…
Q: For each wet mount, describe the appearance of the red blood cells, determine the solution's…
A: The Tonicity of the solution is defined as the capability of the solution to alter its volume by…
Q: A student makes a Venn diagram to compare the functions of carbohydrates and lipis. Carbohydrates ?…
A: Biological macromolecules are the molecules that are needed for enough amount in the body. There…
Q: What is the function of LARP1 and where does it bind? Select an answer and submit. For keyboard…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…
Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…
A: We know that Urine is formed by filtering the blood in the kidney in the body. Metabolic wastes such…
Q: How can we organize circuits in the spinal cord to create rhythmic patterns?
A: Introduction The spinal cord, which connects the medulla oblongata in the brainstem to the lumbar…
Q: Discussion on the physiology of kidney which causes or lead to disease such as Chronic Renal Failure…
A: introduction : A persistent impairment of kidney function, also known as chronic renal failure (CRF)…
Q: What can be done at home to reduce the amount of bacteria on food?
A: Bacteria These are single-celled prokaryotic organisms that are present almost everywhere. Some…
Q: A cell contains 97% water and it is placed in a 5% salt solution. a) Which contains a higher…
A: Cell membrane The membrane of cell which is made up of phosphate and lipids. This membrane also…
Q: Sisters U QO The red arrows are pointing at A Sisters U Homologs Sisters and Homologs Neither…
A: As per our company policy, we have to solve first three questions. If you want assistance with other…
Q: line on July 12, 2017. According to statistics from the Ministry of Health, there were 2,268 ses in…
A: Leptospirosis is a rare bacterial infection we get from animals. It’s spread through their urine,…
Q: How might humans interact with the system of insect infestation in tomatos in order to produce…
A: Introduction Like animals’ plants are also affected by various pathogenic species such as…
Q: What type of epithelium lines the gastro-intestinal tract? O Transitional Simple columnar O…
A: Epithelium tissue consist of cells that lines body surface and glands.In epithelium tissues,cells…
Q: Human (and fly) males are said to be hemizygous for a(n) ________ trait. Responses recessive…
A: Introduction Sex-linked traits are associated with genes that are found on the sex chromosomes. In…
Q: Forest Nursery Subject (For Forester's) Comment on vegetative structures and wildlings as planting…
A: Introduction Forest Nursery:- It is a place or an area where forest seedlings, plants, trees, and…
Q: What is the name of the first cervical vertebra? Why is it called that? What is the name of the…
A: Atlas is the name of our first cervical vertebra. It begins from the base of the skull. It is in a…
Q: How change, large and small, has an effect on the ecosystem?
A: Introduction Ecology is the study of interactions between an organism and its surroundings. It…
Q: 4. Compare the bat to the bird. Identify the humerus in each. Where is the bat's ulna? Are there any…
A: The animal kingdom has diverse firms of organisms constructing millions of species. Bats are mammals…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: You compare two strands of mtDNA and discover that there are 3 differences in base pairs between…
A:
Q: Discuss Equality in the Sexes in Human Evolution. What is it all about?
A: Evolution is the study where changes in populations and communities are observed over many…
Q: N 8 Which of the following is a valid comparison of the net primary productivity of a salt marsh to…
A: Primary production in ecology is the amount of organic compounds synthesised from atmospheric or…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Given , A population consists of 300 individuals with the following genotypes: AA – 100…
Q: A female who is heterozygous for tongue rolling reproduces with a male who is homozygous recessive…
A: Genotype can be define as the combination of charecteristics which can be observed by our naked…
Q: Greg competed in three consecutive races; at the end of the third race Greg was out of breath and…
A: Given that Greg competed three consecutive races but at the end of the third race Greg was out of…
Q: Match the distinguishing feature on the right to the vertebra on the left. typical cervical axis…
A: Vertebrae Vertebrae is the 33 individual bones that are interlocked with each other and make a long…
Q: Question:- Which of the following statements about photosynthesis are FALSE? a) Photosystem II…
A: Photosynthesis is the process by which chlorophyll containing organisms produce organic molecule…
Q: The following contains the same concentration of particles in comparison t another body of fluid: O…
A: Introduction: The overall solute concentration in a solution is referred to as osmolarity. There are…
Q: Draw a picture of mitochondria. label the inner membrane, outer membrane, Inter membrane space and…
A: Mitochondria is the powerhouse of the cell. This organelle is involved in cellular respiration that…
... ..
Answer BOTH
Explain
will upvote
Step by step
Solved in 2 steps
- Examine the following pedigrees. Which is the most likely mode of inheritance of each disorder? (a) autosomal recessive (b) autosomal dominant (c) X-linked recessive (d) a, b, or c (e) a or c 10.Does the phenotype indicated by the red circles and squares in this pedigree show an inheritance pattern that is autosomal dominant, autosomal recessive, or X-linked?Achondroplasia is a rare dominant autosomal defect resulting in dwarfism. The unaffected brother of an individual with achondroplasia is seeking counsel on the likelihood of his being a carrier of the mutant allele. What is the probability that the unaffected client is carrying the achondroplasia allele?
- A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What if the couple wanted prenatal testing so that a normal fetus could be aborted?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What is the chance that this couple will have a child with two copies of the dominant mutant gene? What is the chance that the child will have normal height?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. Should the parents be concerned about the heterozygous condition as well as the homozygous mutant condition?
- In the human pedigree shown below, black filled symbols indicate individuals suffering from a rare genetic disease, whereas empty symbols represent people who do not have the disease. Based on the pedigree, what is the most likely mode of inheritance of this rare genetic disease? O Y-linked OX-linked dominant Autosomal recessive O Autosomal dominant OX-linked recessiveIn the human pedigree shown below, black filled symbols indicate individuals suffering from a rare genetic disease, whereas empty symbols represent people who do not have the disease. Based on the pedigree, what is the most likely mode of inheritance of this rare genetic disease? Hodo O X-linked dominant OX-linked recessive O Autosomal dominant O Autosomal recessive Y-linkedThe following pedigree shows a family in which an inherited condition is apparent. The muscle biopsy from the one of the affected persons shows ragged red fibers and parking lot inclusions on microscopy. What is the most likely mode of inheritance for this condition? Answers A - E A Autosomal Dominant B Autosomal Recessive C Mitochondrial D X-linked Dominant E X-linked Recessive O O TO 0 ☐ Q
- What is the most likely inheritance pattern shown in image B, below? B A E KEY Homozygous Homozygous Heterozygous Heterozygous Wild Type Male Female Male Female Male Note: Completely red symbol denotes an individual exhibiting the phenotype of interest CI 11 III IV V 1/4 A Autosomal Dominant Autosomal Recessive Sex-linked Dominant Sex-Linked Recessive Mitochondrial 1/2 1/2 1/2 1/2 Wild Type Female 1/4 1/2 B Affected Known carrier Affected female Normal female Affected male Normal malePlease consider the following pedigree. Assume that people who marry in to the family do not carry the allele unless otherwise indicated. Assume complete penetrance. I II 5 6 III 6 IV 1 2 a. Is it possible for the inheritance pattern for the trait illustrated in this pedigree to be as a result of each of the following? Answer yes or no. (i) an autosomal recessive allele (AR) (ii) an autosomal dominant allele (AD) (iii) a X-linked recessive allele (XR) (iv) a X-linked dominant allele (XD) b. Provide a genotype for individual III-6 for the most likely mode of inheritance as determined in (a).In the following pedigree of an autosomal recessive disorder, what is the probability that IV-1 will be affected? I II III IV 1/2 1/12 O 3/4 2/3 O 1/4 Rr 1 R 2 Rr 2 R 3 RR 3 R 1 5 Rr 4 2