Given a solar collector facing 30° southeast with a tilt angle of 45° and latitude of (Latitude 42.69° N), calculate the following clear-sky solar radiation on the collector surface at solar noon on June 21: a. Beam radiation b. Diffuse radiation C. Reflected radiation with a reflectance of 0.2 d. The percentages of the beam, diffuse, and reflected radiations with respect to the total radiation

Q: 6. The most commonly occurring effective kerogen- and fortunately the one that produces both oil and…

A: The kerogen is a type of organic material which have potential source of oil and gas deposits. The…

Q: Georgia is conducting research on how the drug simazine affects frog survivorship. She has one…

A: To create the random no. sequence ,read across as if you are reading a book and record the last no.…

Q: What kind of geological formation is shown in the outcrop in Figure 11.20, and what sequence of…

A: Geological formations are natural structures in the bedrock of earth with distinct lithologies.

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: discuss the relationship of atmospheric pressure to other physical quantities (e.g. air density,…

A: Note:- You have posted multiple questions. As per Bartleby guidelines we are required to answer…

Q: Feathers in birds today have different (but often overlapping) purposes, such as insulation,…

A: Caudipteryx was a plant-eating dinosaur that lived around 126 million years ago. It has small downy…

Q: • If you were to walk along the bank of this stream from point A to point B, you will have walked a…

A:

Q: A The world is full of things that are strange and out-of-place. Read the following information and…

A: The moai were created between roughly 1000 C.E. and the second half of the seventeenth century, and…

Q: What are the two main types of minerals?

A: Answer) A mineral can be defined as the solid, inorganic, substance that has also definite chemical…

Q: In coastal areas, carry capacity cannot be used to determine the effect of development of wetland…

A:

Q: PI 0 Abrasion 100% Stone Mountaip Granite 20 40 Av. Appalachian Grantes (Basu) Panola Adamellite 60…

A: A ternary phase diagram illustrates potential phases and their equilibria for a mixture of three…

Q: Which of the following are climate change impacts to the Northeast US described in the 4th National…

A:

Q: Give examples of Step Input, Ramp Input, Rectangular Input. Draw diagrams where necessary

A:

Q: In the following phylogenetic tree, the darker, bolder areas with filled in (red) circles…

A:

Q: Why does the rainshadow desert form on the downwind side of the mountains? O The air mass has…

A: Rainshadow desert forms on the downwind side when mountains block the moist air on the upwind side.

Q: mudstone conglomerate A 4 limestone sandstone A 4 4 Δ Δ Plaa loa ALA Map A Section A breccio shale 4…

A: Geologic cross sections are very important for the study of the subsurface of the investigated area…

Q: A closed, rigid tank at 60 Celsius contains only water vapor at a relative humidity of 50% the total…

A:

Q: As we explore and observe the features here in Blacktail Canyon, we need to identify the various…

A: INTRODUCTION  Blacktail Canyon:  A magnificent and unique side canyon that seems to instill…

Q: the mineral groups and solid solutions within the Bowen Reaction Series using Phase diagrams…

A: Bowen's Reaction Series:  Petrologist Norman Bowen and others in the early 1900’s conducted…

Q: A paleoecological proxy is preserved material that is usually climates or environments.…

A: Paleoclimatology is declines of geology which deals with the study of past climates. As we know it…

Q: Using the image below, where does the 2015 channel and that from 1990 deviate the most? Why did the…

A: Meander is the sinuous curves in the river channel. A meander forms when river or stream cuts…

Q: angular diameter (in arc seconds) 2.06 X 105 = linear diameter distance

A: Planetary nebula is a emission nebula consisting of an expanding, ionized gas ejected from red…

Q: What kind of name that bug?

A: The bug in the picture above seems black in color and is covered with greenish-yellow fur. This…

Q: Figure 5 is a schematic map of a small hypothetical area located within the local map you just…

A: 6.  Soils on which meadows grow are warmer, have Bw layers, and have higher calcium, higher organic…

Q: Analyzing the decay activity of a buried piece of wood provides a measurement of: the time elapsed…

A: Decay activity of a buried plant refers to the loss of C-14 in it gradually. When a plant or animal…

Q: Which major city's water resources are mainly from local and shallow aquifers? Paris, France New…

A: Moscow Russia: Water Resources:  Moscow is considered as one of the city located in Russia has the…

Q: All of the following are parasitic EXCEPT which? Nematoda Annelida Platyhelminthes All of the above…

A: Answer) Parasitic is the term that we use to define parasite. Any organisms that lives on any other…

Q: Distance Tine In the situation from the question above, what is happening between points D and F?…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Complete Part B - this is a ratio and proportion problem (from basic math skills) Part B The table…

A: Part B 12756 km ( the Earth's diameter)/3.5( the proportional size)= 142984km (Jupiter's diamer)/x,…

Q: A collision between two disk galaxies is likely to produce Select one or more: a. a large elliptical…

A: The collision of two or more galaxies can result in galaxy mergers.

Q: Please help with these geology questions 1. When a megathrust earthquake of magnitude 8 or 9 occurs…

A:

Q: What similarities do you notice about the high and low tides in Woods Hole, Seattle, and either…

A: INTRODUCTION TIDES :           Tides are very long-period waves that move through the ocean in…

Q: As discussed in lecture, mutualisms have been used in all of the following examples EXCEPT which?…

A: Mutualism is an interrelationship between two species that becomes useful or beneficial for both.

Q: 39. Upper level winds tend to blow from the low latitudes to the high latitudes as a result of: (A)…

A: There are two types of wind are there   Surface wind are the winds which flows in slow velocity.…

Q: Based on its morphology, which type of delta is pictured above? O river-dominated

A: Delta: Delta is a triangular wetland and usually flat land shaped that forms when rivers enter into…

Q: Cite an example of a disaster problem (from d last 10 years only) and suggest a solution that would…

A: Disasters are serious interruptions to the working of a local area that surpass its ability to adapt…

Q: ermeable surfaces in deserts and arid lands can lead to, or caus apid reshaping of landforms plenty…

A: Introduction The questions here belong to different types of glaciers and the desert landforms.…

Q: What are emissions are from a tonne of co2?

A: The Sun's radiation warms of the Earth's surface. The heated surface of the Earth radiates this heat…

Q: 6. If the specification indicates a range of ± 2%, what are the acceptable values of moisture…

A: Weighing the dry soil after it has been dried in an oven allows us to determine the moisture content…

Q: All minerals are

A: A mineral is a homogenous solid that is either made of a single native element or two more…

Q: Speciation is complete when populations look different from one another. True False

A: Answer) Speciation is the process by which two populations of the same species becomes genetically…

Q: 8. The Santa Rita Well is a famous oil producing well from West Texas. In this system, oil was…

A: The Santa Rita oil well producing oil from the West Texas.  The oil is producing from the Texas…

Q: Which of the following are equality operations? Select all that apply. a. > b. AND C. OR d. <

A: Ans      None

Q: Some people have proposed imposing rules similar to automobile "takeback" programs whereby plastics…

A: Ans 3   Introduction :  Plastic waste and associated pollution and crisis have become a huge…

Q: 1. How do rocks fold? (Draw and Discuss the Flexural slip, Flexural flow, and Tangential…

A: A fold is a curve in the stone layers. Collapsing: Is a kind of earth development coming about…

Q: 42. Deserts occur at ca. latitude 30 N and 30 south because: (A) that is where incoming solar…

A:

Q: How many galaxies are there in a typical group of galaxies? Select one or more: a. a few dozen b. a…

A:

Q: CO₂ (parts per million) 380 340 300 260 220 180 400 Figure 2 - Historical Carbon Dioxide Levels…

A: Option A Carbon Dioxide Concentrations Well Above Levels from the Last 400,000 Years

Q: Which of the following is NOT a depositional landform of shorelines? dunes O granite bedrock…

A: Note - according to our guidelines we can answer only one question and rest can be reposted.

Q: If an earthquake measures 3.4 on the Richter scale, what is the intensity of this earthquake,…

A: The magnitude R of an earthquake of intensity I is defined as R=log(I/I0) where I0 is a minimum…