angular diameter (in arc seconds) 2.06 X 105 = linear diameter distance

Q: John is a convertible car enthusiast. He is planning to take a month long summer driving holiday in…

A: Weather of a country keeps on changing owing to the changes in the temperature and humidity of the…

Q: What are the similarities of Slab Pull Theory and Mantle Convection Theory?

A: The movement of tectonic plates is driven by convection in the mantle. In basic terms, convection is…

Q: Given: A 62 km² drainage basin in the Boreal region on northwestern Canada has three major cover…

A: In general, the density of freshly fallen snow increases as the temperature rises.

Q: Explain the difference between the Natural Greenhouse Effect and Anthropogenic Greenhouse Effect.

A: Greenhouse effect is the natural warming of the Earth due to the presence of some gases in the…

Q: What are the risk assessments for making cup of tea

A: Answer: A risk assessment is a method for locating prospective dangers and examining what might…

Q: RNA can be found both inside and outside of the nucleus. RNA and DNA can only be found inside of the…

A: Answer) - 2nd option is incorrect because RNA can be found inside or outside of the nucleus while…

Q: A meteoroid with a mass of 500 kg is hurtling through the Earth's atmosphere at 5,000 m/s. Which of…

A: Here the earth pull on meteoroid will be equal to gravitational force by earth on meteroid  Which…

Q: If the rate of change of Cl₂ is -0.0420M/s, what is the rate of change of NO? 2NO(g) + Cl₂(g)…

A:

Q: Who drew a simple figure of the Galaxy by observations at the first time? Select one or more: a.…

A: we need to write down the correct answer.

Q: Question 3 How do you distinguish a rock from a mineral? Audio 0:00/0:22 A B C «» С Speed: 1x…

A: 3. Minerals are natural substances, which are consisted of elements. These have definite crystal…

Q: Earth's history, glacial periods:     have happened throughout the history of the planet…

A: Although the glacial period we are presently experiencing is less severe than it was 20,000 years…

Q: Brahe Copernicus Kepler [Choose] [Choose] [Choose] < <

A: In 1514, Copernicus set out his views on the universe and proposed a model known as heliocentric…

Q: If a source of light is approaching toward to you, the frequency of the detected light Select one or…

A: Ans: a) becomes higher The frequency that the observer receives as the light source moves in their…

Q: Write a paragraph describing the environmental issue. Use environment science terms and ideas. to…

A: Carbon Emissions:  According to the climatologists, carbon dioxide is a colourless non poisonous…

Q: on timescales of years to seasons, the primary effect of volcanos on climate is changes in albedo…

A: Volcanic eruptions cause flow of gases including greenhouse gases, water vapor, solid rock pieces,…

Q: Question 50 Where can one find large quantities of loess in the Midwestern United States? The Black…

A: Loess Hills of the United States: Loess is a wind deposited slit that are composed in the top most…

Q: A star rotates around the Galactic center with the rotational speed of 200km/s at 25,000ly from the…

A: The relationship between an object's period and average separation from the object it circles is…

Q: mudstone conglomerate A 4 limestone sandstone A 4 4 Δ Δ Plaa loa ALA Map A Section A breccio shale 4…

A: Geologic cross sections are very important for the study of the subsurface of the investigated area…

Q: Suppose a galaxy is 48 Mpc away from us. How many years ago did the light we're receiving today…

A: Given the galaxy is 48Mpc away from us.  We know the speed of light is 3.0 x 105 km/sec.  From which…

Q: 1.Petroleum-based fertilizer

A: Petroleum Based Fertilisers *Large amounts of petroleum and other fossil fuels are used in the…

Q: The reason why areas near the Equator don't keep getting hotter and polar regions colder:    A.…

A: The equator region gets more direct sun light. So, the sun light is intense and has more day light…

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: During the Cretaceous, when the dinosaurs lived, atmospheric CO2 was higher, the climate was warmer…

A: Option C Was higher than today

Q: 5. Mt. Rainier, Washington: the west side glaciers. Should these glaciers all melt away, they will…

A:

Q: is The northern hemisphere is closest in proximity to the Sun in June?

A: Answer:  No, the northern hemisphere is closest in proximity to the Sun during early January and…

Q: What kind of feedback loop is the following example? Volcanic eruptions put stratospheric aerosols…

A: Mainly there are two types of feedback  positive feedback: The phenomena happening, is continuously…

Q: Question 24 What conditions are needed to produce speleothems? O jointed or fractured bedrock O all…

A: Question 24. What conditions are needed to produce speleothems? Answer: The option “all of these…

Q: [Example] Beer with a specific gravity of 1.042 and acry viscosity of 1.4 x 103 N-s/m² contains 1.5%…

A:

Q: Look over the region and examine the mountains, note their shape, ground cover, and height. Then…

A: How do the Shenandoah Mountains compare to the Rocky Mountains?Answer: Option (d) All of the…

Q: What processes oxygenated Earth's early atmosphere? Multiple Choice cyanobacteria photosynthesis…

A: INTRODUCTION Photosynthesis :                           Photosynthesis is the process by which…

Q: explain Water deep in the earth

A: It is believed that deep beneath the Earth we have more water than the water present in the ocean…

Q: A The world is full of things that are strange and out-of-place. Read the following information and…

A: The moai were created between roughly 1000 C.E. and the second half of the seventeenth century, and…

Q: What is the difference between coal and oil and gas? Multiple Choice Coal is from remains of plants.…

A:

Q: The main reason the Santa Ana Winds are hot:    A. They bring heavy rainfall B. They come from a…

A: Santa Ana winds are dry, hot and mysterious winds as it contains the warm winds blowing from East.…

Q: Ice sheet is another name for mountain glaciers. O True O False

A: The ice may be stores in continental glaciers and mountain glaciers. The mountain glaciers may exist…

Q: Describe the different bones that were modified from the common ancestor to create bird and bat…

A: Both bird and bat wings are similar in wings, but not as forelimbs. Avian and bat species did not…

Q: ys with walls and floors shaped ok different taken on a multitude a

A: Introduction Glaciers make different features from their deposition and erosion actions. Glacial…

Q: Using the contour lines on this map, which area along the red line is steeper A to B or B to C? a. B…

A: Introduction The contours are said to be steep where the distance between two contours is the least…

Q: Recent and ongoing changes in climate have reduced the size of glaciers in the last century. O True…

A: On average, glaciers worldwide have been losing mass since at least the 1970s (see Figure 1), which…

Q: Explain the following briefly: 1.The usual course of life as individual age and replaced by other…

A: solution

Q: Where are most of the Milky Way's open clusters found? Select one or more: a. in the disk b. in the…

A: There are mainly two types of clusters found in the Milky Way - Open cluster and Globular cluster.…

Q: hat was delisted (no longer a U.S. national e Park) mal park annexed to Alberta) operated by private…

A: Introduction National Parks are made to save biodivesrity and flora fauna of a region and hence the…

Q: Which theory states that the entire crust is broken and is continuously moving? A. Continental Drift…

A: There are about a dozen large plates and a number of minor plates that make up the Earth.

Q: can someone help me how to read the Temperature(T) at a given pressure level, The dew point(Td) at a…

A: The Skew-T Log-P provides a nearly immediate snapshot of the atmosphere up to around 100 millibars…

Q: How many grams of NaCl are in 1.00 liter of sea water?

A: NaCl is having a molecular weight of 58.5g/mol. NaCl or sodium chloride is a significant contributor…

Q: .Why does an occurrence of pandemic like COVID-19 is an environmental issue?

A: Since you asked multiple type question we are going yo provide only first answer as per our Q&amp;A…

Q: Examine the following maps: https://www.arborday.org/media/map_change.cfm. A map with a key is at:…

A: Higher temperatures will cause more precipitation to fall as rain rather than snow, which will cause…

Q: List in order in which the major types of animals appeared on earth

A: Q. List in order in which the major types of animals appeared on earth Answer:  Followings are the…

Q: D Question 26 A caldera is a very large hot spring. True O False

A: Note - according to our guidelines we can answer only first question and rest can be reposted.

Q: You measure the spectrum of a distant galaxy and determine that the redshift is z = 11.5. How many…

A: General information - In physics, a redshift is an increase in the wavelength, and corresponding…