Fish protein electrophoresis. These all come from muscle of diverse species of fish. Analyze a protein gel and see if you can rationalize similar looking lanes belonging to related fish species.  look at the gel and see if you can see any similarities. what you think are the 2 or 3 most similar fish.Then, look at the fish evolutionary tree.should be read left to right. Fish alphabetical order is catfish, flounder, orange roughy, salmon, shark, swordfish, and tuna.

Q: creating phylogenetic trees from dna sequences in order 3 steps

A: The term evolutionary tree was used by Charles Darwin to describe a phylogenetic tree. It depicts…

Q: Which of the following is a good example of Natural Selection occurring in the human population?…

A: Example of natural selection occuring in human population.

Q: Read each of the following descriptions of hypothetical species. Then indicate which mode of…

A: Introduction :- Stabilizing selection occurs when natural selection favors the average phenotype in…

Q: Viruses area. protein coats that contain DNA or RNA.b. simple eukaryotic cells.c. simple prokaryotic…

A: The viruses are known as the infectious parasites that contains nucleic acid enveloped in protein…

Q: language nitrogen bases Part 5: Translation - the 2nd step in protein synthesis language (A, U, C,…

A: Transcription is the process in which messenger RNA is synthesized with the help of the instructions…

Q: Null hypothesis vs alternate hypothesis.  what are the differneces

A: "Research" is carried out to assess the validity of a hypothesis" or an interpretative framework, to…

Q: There is another option for the word bank that I can't show in the full image it just says amniotic…

A: similarities:: 1. The lamprey, tuna, salamander, turtle, and leopard all have vertical coloumn.…

Q: This figure represents the following evolutionary concept:

A: Evolution is the process of change in characteristics of organisms over generations. Evolution by…

Q: need a good answer.with explanation.Thanks 1- Which of the following species appeared earliest in…

A: 1- Which of the following species appeared earliest in the fossil record? Choices ( Homo…

Q: n is forever. Do you agree or di

A:

Q: Match the words. There are three phases of evolution expressed in the modern theory of evolution.…

A: Introduction :- Reproductive isolation is a biological mechanism that prevents two populations of…

Q: My dear colleagues, I was also able to trace the lineage of a family of these remarkable Rabandu…

A: Diseases that are transmitted genetically is of five types - autosomal recessive, autosomal…

Q: Drag the correct amino acid into the corresponding box according to the roles they play. Reset Help…

A: Amino acids are the biological molecules which combines with each other to form proteins /…

Q: An adaptation isa. any trait that arises from a mutation.b. a trait that increases the reproductive…

A: Answer is a.)  any trait that arises from a mutation.

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA  is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: Please let me know what you find out, it could be quite the discovery if we can figure out how these…

A: Genetic inheritance: An offspring obtain traits from their parents through sexual or asexual…

Q: Which of the options below is entropy driven  the assembly of the DNA double helix. the folding of…

A: Entropy is the measure of disorder and randomness in a system. It is the thermal energy in the…

Q: Felis catus АTGTTCATAAAСCGGTGACTATТTТСAAСТААТСАСАAAGATATTGGTACTCTTTACСТTТТАТТСGGTGCC Homo…

A: Felis catus :  Phylogeny: This is the phylogenetic tree of the order felidae. As you can see, the…

Q: You have just joined a lab to complete an undergraduate research project. The focus of the lab is…

A: Evolution can be studied by collecting molecular data from different species which includes DNA, RNA…

Q: captured and brought to the lab. When an adult female from the other population are placed together,…

A: Isolation is the mechanism in which nature does not allows the mating of the members of two…

Q: Explain how venomous snakes could evolve from a non-venomous ancestor, using the tenants of natural…

A: Snake venom is mostly employed for foraging purposes. especially for killing and subduing prey.…

Q: Calculation problem on genetics. What would be the formula?

A: The allele frequency is a measure of how common a gene variation is in a population. Alleles are…

Q: 2. Why does it take a long time for the bear to evolve to have the new traits?

A: ANSWER 2.) -Bears are iconic mammals with a complex evolutionary history. Natural bear hybrids and…

Q: What Darwin Never Knew. What experiences / observations on Darwin’s HMS Beagle trip influenced his…

A: Charles Darwin was an English biologist and geologist who is well known for his theory of evolution.…

Q: Australopithecus. This was the first stage in human evolution to demonstrate bipedalism, the ability…

A: Homo sapiens belong to Hominids. These were the most primitive human-like creatures. Hominids…

Q: Two sequences aligned using one of the BLAST programs produce an alignment with an expected value…

A: *A BLAST alignment will have an  pair of sequences in which every letter in one sequence is paired…

Q: Fish protein electrophoresis. These all come from muscle of diverse species of fish. Analyze a…

A: SDS PAGE, abbreviation of Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis is a…

Q: Vhich of the following is not one of the four rmain factors that determin OSize of the molecule…

A: Note: As per authoring guidelines solving only first, Kindly repost second question. Find the factor…

Q: Species Species Cladogram Phylogenetic Tree Richness Evenness I. Cladogram vs Phylogenetic Tree…

A: Biology is a branch of science which deals with the study of living organisms and their interactions…

Q: Deadly Nightshade - Solanum nigrum

A: ORIGIN and EVOLUTIONARY HISTORY_ This species is considered to be native to Europe and Asia and…

Q: 63 62 GI G5 G4 GGU AUG GCC AUG CUC TT T GAG CGG ACC CUC UUC UAC R (the strand) GAG AAG The circled…

A: Gene expression refers to producing protein from the template strand of DNA via mRNA as an…

Q: According to the fossil record, lizards and salamanders diverged 40 million years ago. You…

A: The relation between amino acids difference and years of divergent evolution is linear. So, let x be…

Q: Study the figure below and then answer the related questions. It illustrates round worm C. elegans’s…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Please help with Evolution Bio problem please quick! A flock of 300 Red Legged Jabberwockys gets…

A: Approach to solving the question:Allele frequencies observed (current generation):The total number…

Q: mouse squirrel rabbit human flying lemur tree shrew O Humans are equally closely related to…

A: The above diagram is of a phylogenetic tree.

Q: Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O…

A: Protein Sequencing:  Protein sequencing is the technique of determining the amino acid sequence of a…

Q: Deer mice are usually found in the woods and are dark brown in color. The deer mice that live in the…

A: Selection is the process by which various factors determine the reproductive fitness of a population…

Q: Focusing on the nucleobase, and starting from the heteroatom furthest from the glygosidic bond, the…

A: Cytidine is a nucleoside molecule formed when cytosine forms a -N1-glycosidic bond with a ribose…

Q: Evolution favors bigger, stronger, faster organisms. O True O False

A: Evolution is a continuous process of change.

Q: 2. Find the pages in this lab exercise where they are examining the evolution of horses and their…

A: A cladogram is a diagram used in cladistics to show relations among organisms. A cladogram is not,…

Q: The figure given below shows four possible "folding funnels" for protein folding. Each figure…

A: The folding funnel is a specific version of the energy landscape theory of protein folding, which…

Q: Choose from the following list the systems involved in assisting protein folding in vivo (more than…

A: Protein folding is a process by which linear polypeptide chains fold into its functional…

Q: Determine the kind of integral membranes that permit the passage of tiny soluble solutes, ions, and…

A: Through the channel proteins incorporated into the lipid bilayer, ions, water, and metabolites are…

Q: What Darwin Never Knew. What is the genetic basis for the humanness ? List examples from the movie…

A: Introduction:- Darwin gave the theory of natural selection. Natural selection is the process by…

Q: Part A Drag each amino acid into the box corresponding to its classification. Reset Help NH3 CH2 CH2…

A: 1st amino acid is lysine 2nd is asparagine 3rd is glutamate 4th is leucine

Q: . Explain how comparing proteins of two species can yielddata about the species’ evolutionary…

A: Evolutionary relationships can be defined as the pattern in which organisms descend. A phylogenetic…

Q: Quick question. So, A change in the generic composition of a population always means that adaptive…

A: Introduction: Adaptive evolution refers to the changes in any organism's population which enable an…

Q: Here is the sequence of an mRNA molecule: GUC/GGG/CUC/AGA/GAA What is the protein sequence that…

A: A codon is a group of three nucleotides that stands for a particular amino acid or signal to cease a…

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.