What kind of tools did Australopithecus robustus have that researchers believe were used to dig into termite mounds? Natural rubber fishing sticks Bone digging tools Stone axes Woven nets

Q: ing to the video "Ben Goldacre: Battling Bad Science" from Assignment 5.2, which e statements is…

A: Placebo is a kind of substance which produces no medical effect. Placebo is given to create a  false…

Q: Describe the process of oogenesis

A: Sexually reproducing organisms have a reproductive system consisting of primary sex organs called…

Q: What muscle?

A: Muscle is a soft tissue found in most animals. Muscle cells contain protein filaments of actin and…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: Identify the type of muscle found in the picture (choices: smooth muscle, skeletal muscle, or…

A: Smooth muscle: it is usually unbranched, non-striated, and single nucleated muscle fibers.  Skeletal…

Q: QUESTION 22 Which of the following is TRUE about the stomach? O The stomach has three layers of…

A:

Q: Sequence of excitation-contraction coupling

A: Excitation contraction coupling is the order of events in which an action potential in a myocyte…

Q: Cell body of somatic motor neuron Cell body of an ANS preganglionic neuron Cell body of an ANS…

A: The autonomic nervous system is referred to as the ANS. It is a division of the peripheral nervous…

Q: Identify the highlighted fiber.

A: the highlighted fiber are :

Q: Define atrophy

A: Our body is made up of various systems in which the organs have a clear-cut division of labor. Our…

Q: Define M line

A: The myofibrils are long cylindrical fibers, arranged parallel, extending from one end of the fiber…

Q: What is lac operan

A: The information stored in the genes is decoded for the synthesis of a functional protein by a…

Q: Appendicular S

A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: What type of muscle is pictured below?

A: The muscular system is made up of special types of cells known as muscle fibers. The main function…

Q: Awkward posture Reasons why?

A: Good posture involves training the body to stand, walk, sit and lie in positions where the least…

Q: Frog muscular system. Identify numbers 2, 4, 6, 8

A: Introduction:- Frogs rely upon a few sorts of muscles to do their ordinary everyday exercises, for…

Q: Identify the structures a-d. (a) (b) (c) (d)

A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…

Q: What is the shape of a cardiac muscle cell?

A: Muscle cells, usually renowned as myocytes, these are the cells that form up muscle tissue. There…

Q: 1. How might BMI information be useful to individuals? 2. Is BMI information alone enough for…

A: Body composition is the percentage of fat and non-fat mass in your body.  The body composition of a…

Q: Skeletal muscle tissue;Location _______________________ Function ______________________

A: Muscles are one of the four main types of tissues found in the human body.

Q: CONCEPT APPLICATION 3. Imagine you are painting your bedroom at home. You get tired of repeatedly…

A: Introduction  Skeletal muscles, often known as muscles, are parts of the vertebrate muscular system…

Q: Processing of gari

A: Given: Need to find how Gari is processed.

Q: 6.

A: The excretory system is the part of an organism's body that is responsible for excretion or the…

Fungal Infections

Fungal infection can be defined as an infectious disease caused by fungi. A fungal infection is also referred to as mycosis. Fungal infections are contagious, spreading from person to person. Mycosis can be contracted even from an infected animal or contaminated soil. The most common symptom is skin rashes and vaginal discharge in females.