Answered: Find the PCR expected size for Kan…

Science

Biology

Find the PCR expected size for Kan cassette sequence

Case Studies In Health Information Management

3rd Edition

ISBN:9781337676908

Author:SCHNERING

Publisher:SCHNERING

Chapter4: Revenue Management

Section: Chapter Questions

Problem 4.16.2C

See similar textbooks

Related questions

Q: please solve this with step-by-step calculations and explanations.

A: The following is a step-by-step solution to this problem:a. In order to determine the melting…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19?

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: Above what amplicon size is this PCR reaction dNTP limited? The reaction contains 35 pmoles of each…

A: The polymerase chain reaction (PCR) is a relatively common technique that amplifies a DNA template…

Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…

A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…

Q: List essential components required for the DNA sequencing reaction based on the Sanger method.…

A: DNA sequencing is the process of determining the sequence of nucleotides in a piece of DNA. In…

Q: Make the PCR Cocktail This table lists the ingredients, stock reagent concentrations, and…

A: Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside…

A: Sanger sequencing, also termed chain -terminator sequencing process is based on the ability of the…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: Our PCR samples already contain loading dye, but sometimes this isn’t the case. If your samples…

A: Gel electrophoresis is a process that helps in the separation of DNA fragments based on sizes with…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: A primer is defined as the short single-stranded DNA sequence, required in the polymerase chain…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the…

A: Introduction Plasmid Vectors: these are like the artificial vehicle to deliver our gene of insert…

Q: You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop…

A: If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the…

Q: ven though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA…

A: Answer: EUKARYOTIC GENOME is more complex and larger than PROKARYOTIC GENOME beacuse prokaryotic…

Q: During PCR amplification in preparation for DNA sequencing, why were there different colors at the…

A: Polymerase chain reaction is a process by which millions of copies of a specific DNA segment are…

Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…

A: Pyrosequencing is a form of sequencing that works by the principle of DNA replication. The template…

Q: Aside from gel electrophoresis Give another method to quantify DNA. Explain the concept behind this…

A: DNA quantification is a type of quantification of nucleic acids that is used for the determination…

Q: Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII…

A: Restriction endonucleases are the enzymes which recognize and cleaves DNA to make smaller fragments.…

Q: For the following short sequence of double stranded DNA and the given primers, there will be one…

A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…

Q: The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works,…

A: This scenario based on DNA sequencing. DNA sequencing is the process of determining the order of…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Find the PCR expected size for Kan cassette sequence

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: What is PCR

VIEW

Step 2: PCR expected size for Kan cassette sequence

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
In PCR amplification Why is it important to know the length of the sequence you amplify?
A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify bp 936-4,635 of a 10,908 bp plasmid. Calculate the expected PCR product size (in bp).
The final amount of each primer required in a PCR reaction is 25 picomol. If the total volume of the PCR reaction is equal to 100 µl and the stock concentration of each primer is equal to 0.0025 mM. Calculate the volume of stock primer that needs to be added in order to ensure a primer amount of 25 picomol.
Explain how the percentage efficiency of a real-time PCR reaction is determined using a theoretical experiment and why this is essential in any real-time PCR analysis.
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
The process of PCR essentially revolves around three phases. Briefly describe these phases and the events that occur in them. Take note the temperature on which these phases take place.
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.
Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?
Analyze the PCR products in Fig. 1A by describing your observations and the PCR result. Your analysis should be in maximum of 5 sentences in bullet form. Include the following in your analysis: Observations: Are bands present? If yes, what the approximate size in bp of each band? Results: Was amplifying the target gene successful?
The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended, the resulting amplicon will be how many base pair (bp) long? 5' ACGTGCGAGCACGTATATATGTCGCGTGCTGAGTGTAGCGTATGCGAATCACCGC 3' 3' TGCACGCTCGTGCATATATACAGCGCACGACTCACATCGCATACGCTTAGTGGCG 5' 31bp 39bp 42bp 47bp None of the above
To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on gel electrophoresis, specific sequences can be amplified by PCR. For a sequence of a 100 base pairs, calculate the number cycles of PCR required to generate 1 ng of DNA, when starting from a single copy. Note that the molar mass of an average DNA bp is 600 g/mol.