Fill in the blanks: Modified True or False: Write BIOCHEM if the statement is true. If the statement is false, provide the correct answer for the word(s) that are indicated in bold letters. Question: Based on its structure, a ribonucleic acid differs from DNA in a manner that it has an H group in its C2. ANSWER:

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Describe the process of protein synthesis and localize where each step takes place. Use the…

A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…

Q: During replication, Primase, DNA Polymerase I, and Ligase are used most frequently on

A: Answer  Option D - The lagging strand

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Explain DNA polymerase?

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: how is HIV related to biochemistry?

A: HIV stands for Human Immunodeficiency Virus. It is a positive strand enveloped RNA virus, belongs to…

Q: Identify two problems associated with genetically modified organisms.

A: A genetically modified organism (GMO) is a living organism whose DNA has been altered via the use of…

Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: This…

A: In prokaryotic DNA replication , the  DNA copies it DNA and transfer the copy of DNA into daughter…

Q: List two specific examples of DNA damage and what causes it

A: Step 1 of 2:)   DNA damage is caused by many things this damage can lead to mutations which can…

Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein]  sequence known as a [promoter, start codon,…

A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…

Q: ion, mRNA codons, peptide bonds, nucleus.

A: The process of transcription to translation decides the fate of genetic material. Both of the…

Q: . Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling…

A: The answer of the following question is given below.

Q: Describe the chemical synthesis of DNA and its uses in the fields of biotechnology and molecular…

A: DNA synthesis is the natural or artificial creation of deoxyribonucleic acid (  DNA  )…

Q: Translation is a process which is best symbolized by   a. RNA --> DNA   b. DNA --> RNA   c.…

A:

Q: What type of RNA corresponds to the statement? Choices: mRNA, tRNA, Prokaryotic, rRNA, Eukaryotic,…

A: RNA is a polymer of nucleotides attached together via phosphodiester bonds. RNA is generally…

Q: Describe the process of translation of DNA to RNA.

A: DNA is the genetic materials of us.

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Explain how ubiquitination plays role in maintaining certain levels of proteins needed by including…

A: Ans: Ubiquitination: This process is referred to as kiss of death for various proteins. Under this…

Q: In the process of DNA replication, there are four important enzymes. Construct a table, provide what…

A: DNA replication is semi conservative process involves process of producing two identical DNAs from…

Q: explain Nucleotide excision repair

A: Nucleotide excision repair is one of the defined methods of DNA repair. It is characterized by the…

Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…

A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…

Q: Using the illustration of DNA replication given below label the following:

A: DNA is the hereditary material. At the point when the cell separates, the girl cells get an…

Q: Explain the relative importance of the bioassay during the different phases of research and…

A: Bioassays are used to determine the concentration of a substance by exerting its effect on the…

Q: RNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides…

A: Deoxyribonucleic acid (DNA) comprises the genetic information or the instructions required by an…

Q: a) enzymes are used to assemble an insulin gene, which is then attached to bacterial DNA. b)…

A: Enzymes are biological catalysts that enhance the speed of a reaction. This is performed by lowering…

Q: For each of the following sentences, fill in the blanks with the best word or phrase selected from…

A: a) transcription b) mRNA c) t-RNA

Q: choose replication, transcription, or translation,  both replication and translation , both…

A: translation ….. mRNA to proteins transcription ...... DNA TO RNA replication ...... DNA TO DNA…

Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

A: CAT  CTA  CAA  ATA  GCA  CCT  AAT  TGT  G           (DNA)

Q: which molecule copies the DNA message for building a particular protein? what is this process…

A: Deoxyribonucleic acid (DNA) is a self-replicating substance that is found in almost all the living…

Q: Explain the possible repercussions to an organism, when a mutation occurs in the genome?

A: Mutation   The change or variation occurs in the sequence of DNA is known as mutation. In mutation…

Q: Explain the methods of Protein Engineering?  Please answer at your own words.

A: Protein engineering is the change in protein structure to suit the needs. It may be used in…

Q: Complete the series for DNA replication, transcription and translation by writing the complementary…

A: Introduction: DNA is a hereditary material that passes from one generation to another.

Q: In nucleic acid Differentiate: gene, genome and gene expression

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: discuss the process of DNA transfer.

A: A gene is the functional and physical unit of heredity. Genes are composed of DNA. Some genes act as…

Q: Identify the benefits and risks of Genetically Modified Organisms

A: Recombinant DNA technology: It is also known as Genetic engineering. It is the technique in which…

Q: Give a schematic diagram of how we can Treatment Thalassemia by using gene therapy? Please answer…

A: Thalassemia can be outlined as genetic disorder in which body loses its ability to make hemoglobin…

Q: If Avery, MacLeod, and McCarty had found that samples of heat-killed bacteria treated with RNase and…

A: Avery, MacLeod, and McCarty used heat in their experiment to virulent bacteria, then homogenize and…

Q: List mechanisms by which cells can repair damaged DNA and correct replication errors?

A: DNA repair is a multistep process that is associated with the function of recognizing the damage in…

Q: State the dependent and Independent Variables in the process of RNA and Protein Synthesis lab

A: Transcription is a process of RNA production from the DNA template. This process occurs within the…