Using the figure below, what is the amount of global mean sea level rise associated with the "peak and decline" RCP? (m) 1.0 0.8 0.6 0.4 0.2 0.0 a. 0.74 m b.0.55 m c. 0.52 m d.0.45 m 2000 Global mean sea level rise 2020 2040 2060 Year 2080 2100 RCP2.6 Mean over 2081-2100 RCP4.5 RCP6.0 RCP8.5

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: Introduction : Peripheral proteins are discovered resting on the surface, whereas integral membrane…

Q: 29. If bacteria remove O₂ from the medium, the litmus is... a. Reduced by donating electrons to the…

A: In order to understand how bacteria can affect the litmus test, it is important to first understand…

Q: 4. Match the words with the correct definitions: | Alternation of generations Haplontic life cycle…

A: Biology includes a wide variety of terminologies that describe the many processes of living…

Q: Draw the structure in chair form of N-acetyl neuraminic acid. State occurrence and biological…

A: Sialic acids are an amino sugar category made up of 9-carbon α-keto acids. They’re mostly present on…

Q: How did the diverse feeding appendages of arthropods arise?

A: Introduction  Arthropoda, a subclass of invertebrates with an exoskeleton, is the biggest phylum in…

Q: Question 28 The function of pointed structure C is to store Liver A Stomach Spleen Rectum Pancreas…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: 5. Arabidopsis fruit is a silique, which is a dry dehiscent fruit that splits longitudinally along…

A: The answers are shown below.

Q: The sodium potassium AT Päse Pump functions By transportifg lons Bladiel O True O False Question 4…

A: The transportation of different molecules across the plasma membrane is regulated by the…

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: are located on the X chromosome. The recombination frequency of each table. Construct a chromosome…

A: Start with the genes that are the farthest apart first: C and S are 11%  map units apart and would…

Q: The serotonin molecule has some remarkable properties. It is synthesized by two different two…

A: Hormones are chemical messengers or signaling agents released into the bloodstream by various…

Q: The color of urine is determined mainly by a. diet b. filtration rate c. byproducts of red blood…

A: The urinary system comprises organs like the kidney, ureters, urinary bladder, and urethra. The…

Q: 1. What is the most common bacterial strain that causes Strep throat? 2. How do you get strep…

A: Inflammation and soreness in the throat are symptoms of strep throat, a bacterial illness.…

Q: You are driving down a highway at night and quickly pass a car on your right. But as you look to the…

A: The eyes are the complex sense organs that gather information from the environment, and the brain…

Q: LYCOPODIOPHYTA Taxonomic Account Kingdom: Clade: Class: Order. Family: Genus: Species: Scientific…

A: The scientific process of arrangement of organisms into the hierarchical series of groups or…

Q: Taxonomic Account Kingdom: Clade: Class: Order: Family: Genus: Species: Scientific name: Psilotum…

A: Classification is the systematic grouping or categorization of items into groups or categories based…

Q: SET C EEM ED

A: The chromosome is a compact DNA (deoxyribonucleic acid) molecule with a portion or all of the…

Q: Explain in your own words why ecosystem is a complex system?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Observed Z values (Y axis) are compared to expected Z values for a normal distribution (X axis) 2 y…

A: 1) False This Q-Q plot shows a trait that is not normally distributed. This is because normal…

Q: Select correct properties of alpha-helices: O A. Small amino acids, glycine and alanine, are…

A: Alpha-helix is a secondary structure that is stabilized by the H-bond. Hydrogen bonds forms between…

Q: QUESTION 32 Which pair has similar chemical properties? O ¹H and 22 Na O 12C and 28gi O160 and 32

A: Atoms are the building blocks of matter, and the behavior of atoms in chemical reactions is…

Q: How low GABA affect generalized anxiety disorder ?

A: We know that GABA is an amino acid, which can help our mood. GABA -aminobutyric acid is a chemical…

Q: Q1 Based on the above plot, the maternal heritability value of human height is 0.566/2. (True or…

A: The metric that asses the variance of a trait in a population is known as heritability. The…

Q: What should you do to prevent yourself from any injuries?

A: Damage that occurs in an individual's body due to the action of an external force is known as…

Q: Observed Z values (Y axis) are compared to expected Z values for a normal distribution (X axis) 10

A: Normally distributed data in a scatter plot is visualised by a straight diagonal line between X and…

Q: What structure is labeled B? B A D E G H F

A: They are bean-like structures in shape and their size is around 10 – 12 cm. Primary function of…

Q: Do not copy please

A: Tissue is a level of biological organization that exists between cells and an entire organ. A tissue…

Q: Suppose that extra fingers and toes are caused by a recessive trait, but it appears in only 9% of…

A: Introduction  Traits are observable characteristics of an organism that can be physical,…

Q: Complete the following objectives: Describe types of innate immunity Doscribo 0ach of tho folla

A: Since there are multiple questions in this particular question, I'll answer the first one for you.…

Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…

A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…

Q: Consider the following two peptide sequences. Peptide 1): LKAENDEA ARAMSEA Peptide 2):…

A: The amino-acids sequences have different propensities for forming secondary structures. based on the…

Q: B D E a. Describe each as n= 2 (1 or 2 "sets" of information is held on how many chromosomes). Also…

A: NOTE- as we can provide answer of one question at a time, so I'll give answer to part (b) only. For…