Answered: Draw a schematic diagram for RNA (a)…

Draw a schematic diagram for RNA (a) transcription and (b) translation then label organelles, molecules and proteins involved in each of these processes.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 11QP: Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

See similar textbooks

Related questions

Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…

Q: The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make…

A: Within the cells two types of nucleic acids are found, that are DNA and RNA. They both composed of…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

Q: Number the following steps of protein synthesis in the order in which they occur, starting with 1…

A: Central dogma involves transcribing the information from DNA to RNA and from RNA to protein…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Which of the following statament is NOT TRUE about gene expression?

A: Central dogma consists of replication, transcription and translation.Replication is the process of…

Q: The stringent response involves all EXCEPT A) O reduce expression of rRNA genes B) O reduce…

A: Answer is A.) reduce expression of rRNA genes.

Question

Draw a schematic diagram for RNA (a) transcription and (b) translation then label organelles, molecules and proteins involved in each of these processes.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

1) The nucleolus is a cytoplasmic organelle involved in the synthesis of ribosomes (true or false ) 2)DNA is often referred to as supercoiled because it is most commonly found in cells as two strands of inter-wounded DNA (true or false ) 3) translation is a process of synthesizing proteins based on base sequences of mRNA molecule (true or false )
Translation is the process of ____ and occurs in the ____. a) mRNA assembly, nucleus b) amino acid metabolism, cytoplasm c) assembling polypeptide chains, cytoplasm d) transcript-building, nucleus
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component? A) RNA → DNA RNA → protein B) DNA → amino acid → RNA → protein O C) protein RNA DNA D) DNA - TRNA → MRNA –→ protein O E) DNA - RNA → protein
16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription and translation in your answer (and explain the parts involved in each process) B) Why is RNA transcription a necessary process?
What type of RNA carries the genetic informationrequired for protein synthesis?(a) Transfer RNA(b) Messenger RNA(c) Ribosomal RNA(d) All of these(e) None of these
39)Start and stop signal sequences on a newly translated protein A) Tell the ribosomes when to move to the nucleus B) Help position it within the ER membrane correctly C) Indicate where glycosylation should occur D) Are important for protein modifications in the smooth ER E) Are added in the golgi apparatus
Which statement is TRUE of the CRM (cis-regulatory module)? a) it codes for transcription factors (TFs) b) It is frequently located far from the gene it regulates c) It contains the DNA binding sequence recognized by RNA polymerase d) It includes the coding sequence CDS of the gene
Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP B - mRNA leave the nucleus and attaches to a ribosome STEP C - complementary mRNA attaches to DNA STEP D - the amino acids bond, forming a protein C, B, A, D O A, C, B, D O D, C, A, B O B, C, A, D
The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make up part X. (ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been transcribed. (b) (i) Give one way in which the structure of an MRNA molecule is different from the structure of a tRNA molecule. (ii) Explain the difference between pre-mRNA and mRNA. (c) The table shows the percentage of different bases in two pre-mRNA molecules. The molecules were transcribed from the DNA in different parts of a chromosome. Part of Percentage of base chromosome A G U Middle 38 20 24 End 31 22 26
Which component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomes
Ribosomes in the cytoplasm capture mRNA that can be translated into an enzyme for the lysosome. a) Explain what happens from the time the enzyme begins to form in the cytoplasm until it ends up in the lysosome and also explains how the enzyme is transported to the lysosome?