Do it quickly

Q: Prefix root and suffix of anovulation

A: Medical terminology is a special words used to evaluate conditions , procedures , process . Medical…

Q: Label name only asap

A: We know that there are 119 different species of sharks, dogfish sharks are the second largest…

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: Please Identify the muscle!

A: Organs called skeletal muscles that connect to the skeleton are made of skeletal muscle fibers. The…

Q: Innervates the superior oblique muscle of eye Only cranial nerve that extends beyond the head and…

A: Twelve nerves make up the cranial nerves. They come from the brain and have direct connections to…

Q: What muscle?

A: Muscle is a soft tissue found in most animals. Muscle cells contain protein filaments of actin and…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: Considering the time limit what should be opened first

A: Effectiveness and task prioritization are basic within the planning of an urgent surgical strategy,…

Q: . What would be the consequence of an inactivating mutation in the HO gene in an a cell? [Select]

A: Inactivating mutation This mutation is also called as loss of function mutation. The product of this…

Q: Label A.B And C

A: We can say that Throughout the body, the arteries are used to deliver oxygenated blood and nutrients…

Q: Aphakia and it's correction

A: Eye- The eye is one of the sense organs of the body which is used for seeing different objects. The…

Q: Lebel 1

A: We know that It is the largest bone in the body. It is the bone present on the upper end of the body…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: What type of muscle is pictured below?

A: The muscular system is made up of special types of cells known as muscle fibers. The main function…

Q: Awkward posture Reasons why?

A: Good posture involves training the body to stand, walk, sit and lie in positions where the least…

Q: Frog muscular system. Identify numbers 2, 4, 6, 8

A: Introduction:- Frogs rely upon a few sorts of muscles to do their ordinary everyday exercises, for…

Q: Structures of Skeletal Muscle Figure 5-37 Structures of skeletal muscle

A: The picture is showing the structure of skeletal muscle fiber. The tendon connects the bone to…

Q: Persuasive Speech on Vaccination

A: Vacci-Nation Hey, you! Yes, you! Do you know what vaccines are? Do you know how they work? Most…

Q: There are only two things to remember.  Number One... Don't Stop, and Number Two... Keep Going!”…

A: Frank Zappa's advice encapsulates the essence of perseverance and resilience. It reminds us that…

Q: 1. How might BMI information be useful to individuals? 2. Is BMI information alone enough for…

A: Body composition is the percentage of fat and non-fat mass in your body.  The body composition of a…

Q: Skeletal muscle tissue;Location _______________________ Function ______________________

A: Muscles are one of the four main types of tissues found in the human body.

Q: Processing of gari

A: Given: Need to find how Gari is processed.

Q: sign (+) for positive and a "minus" sign(-)

A: Carbohydrates Proteins Lipids Elements C; O, and H C; H; O; N       P, S C; H; O Ratio of H: O…

Q: Luke tried to go to sleep, but a dripping bathroom faucet kept himawake. Explain.

A: Sleep refers to the state of the boy and mind that typically recurs for several hours every night.…

Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no

A: Introduction :- A muscular artery (or distributing artery) is a medium-sized artery that branches…