DNA Transcription and Translation Directions: 1. Transcribe the DNA sequences below into MRNA. Read the top strand in this direction 5 GTATC CCTTGACTTCAAAGGGC CCATGAAGGGT3' 3' CATAGGGAACT GAAGTT TCCCGGGTACTTCCCA 5 Read the bottom strand in this direction - Top Strand DNA code: GTATCCCTTGACTTCAAAGGGCCCATGAAGGGT MRNA sequence: Bottom Strand DNA code: ACCCTTCATG G G C CCTTT GAAGTCA AGGGATAC MRNA sequence: Tt v Open notes navigator Do Now: Explain 7. Sway Open Ended Question Draw It 4 bp 林

Q: Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.…

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: Draw a general structure of a mature mRNA

A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: write the full form of RNA

A: Nucleic acids are large biomolecules or biopolymers. It is essential to all known forms of life. The…

Q: In details summarize the process of Translation and post translation process.

A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…

Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Explain the elongation steps in bacterial translation

A: The translation is defined as the conversion of mRNA into proteins. The nucleotides in the group of…

Q: Examine what happens during each of the three key stages of translation.

A: After transcription, there is just one step left: translation. It is the conversion of mRNA into a…

Q: Define the following keywords: DNA MRNA protein. tRNA

A: The biological level of an organization is a hierarchy that arranges the living things from simple…

Q: Explain synthesis of RNA in a flow chart- from pre-mRNA to final mature RNA.

A: The RNA transcript first made in a eukaryotic cell is known as pre mRNA. It must be processed into…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: Describe and explain (step by step) how DNA is Transcribed into mRNA. Then describe and explain…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Explain transcription in detail with suitable diagram

A: Transcription is the initial step of gene expression in which the template DNA (deoxyribonucleic…

Q: Caption a diagram of translation, identifying each step in the process and the role of each type of…

A: The process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum is known as…

Q: Discuss how RNA is able to achieve complex structures for its function in cells

A: There are different macromolecules present in living organisms. They include carbohydrates, nucleic…

Q: what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR,…

A: Introduction A ribosome reads messenger ribonucleic acid (mRNA), a single-stranded RNA molecule that…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Q: rRNA sequence analysis:b. Briefly describe why rRNA sequence helps determine relatedness.

A: RNA stands for ribonucleic acid it is a complex compound of molecular weight that functions in…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Summarize the different types of processing that can take place in pre- mRNA.

A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…

Q: Explain the importance of the reading frame of a proteincoding gene

A: A gene is an area of DNA molecule or polymer of amino acid that encodes function. A chromosome…

Q: Describe the roles of ribosome, mRNA & tRNA 's in translation

A: Introduction :- The mRNA contains a series of codons that the ribosome decodes to produce the…

Q: Explain briefly what happens to eukaryotic mRNA before it can be translated to protein.

A: DNA is the carrier of genetic information in almost all organisms except for certain RNA viruses.…

Q: In what functional way is this tissue different from the simple squamous epithelium you observed?…

A: The question you have asked is about the comparison between two types of epithelial tissues - simple…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Transcribe the gene to mRNA sequence and translate the mRNA gene to protein sequence.

A: Genes are sections of DNA which hold the information that are needed to make proteins. Transcription…

Q: Of the options listed below, which one set of features determines the length of the primary RNA in…

A: Primary RNA also called heterogeneous RNA  (hnRNA)  consists of both coding sequence (exon) and…

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: Transcribe the gene to the mRNA sequence and label start and stop codon. Translate mRNA to protein…

A: Gene expression is the process of converting the instructions encoded in a gene's DNA sequence into…

Q: If you have an mRNA sequnece below that looks like : 5' cap,  Cytidine, CCUCUUUUCC,  gene,  AAAAA…

A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…

Q: Define ribosomal RNA (rRNA)

A: Ribonucleic acid (RNA) is a bio macromolecule present in all cells. RNA performs a broad range of…

Q: Splicing involves excision of introns excision of exons addition of exons addition of introns

A: An intron is a portion of a gene that does not code for amino acids.The parts of the gene sequence…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…