DNA Transcription and Translation Directions: 1. Transcribe the DNA sequences below into MRNA. Read the top strand in this direction 5 GTATC CCTTGACTTCAAAGGGC CCATGAAGGGT3' 3' CATAGGGAACT GAAGTT TCCCGGGTACTTCCCA 5 Read the bottom strand in this direction - Top Strand DNA code: GTATCCCTTGACTTCAAAGGGCCCATGAAGGGT MRNA sequence: Bottom Strand DNA code: ACCCTTCATG G G C CCTTT GAAGTCA AGGGATAC MRNA sequence: Tt v Open notes navigator Do Now: Explain 7. Sway Open Ended Question Draw It 4 bp 林

Q: Describe how cDNA is made.

A: A cDNA or complementary DNA (deoxyribonucleic acid) is produced from ssRNAs (single-stranded…

Q: List and draw out four distinctive features of most eukaryotic mRNAs.

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: Draw a general structure of a mature mRNA

A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…

Q: Compare miRNAs and siRNAs, including their functions.

A: Micro ribonucleic acids (miRNAs) and small interfering ribonucleic acids (siRNAs) are non-coding RNA…

Q: describe insertion sequences

A: DNA is the information centre for most organisms. DNA is made up of a long chain of nucleotide base…

Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…

A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: write the full form of RNA

A: Nucleic acids are large biomolecules or biopolymers. It is essential to all known forms of life. The…

Q: Briefly describe two of the tree functions of RNA polymerase

A: RNA polymerase is a catalytic enzyme that is liable for duplicating a DNA succession into a RNA…

Q: Explain the role of RNA polymerase.

A: RNA pol is an enzyme that's liable for the repetition of a DNA sequence into a ribonucleic acid…

Q: Define the following keywords: DNA MRNA protein. tRNA

A: The biological level of an organization is a hierarchy that arranges the living things from simple…

Q: Describe the roles of mRNA, tRNA, and rRNA intranslating the genetic code.

A: During protein synthesis, translation is transforming the sequence of a messenger RNA (mRNA)…

Q: Explain synthesis of RNA in a flow chart- from pre-mRNA to final mature RNA.

A: The RNA transcript first made in a eukaryotic cell is known as pre mRNA. It must be processed into…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: Describe and explain (step by step) how DNA is Transcribed into mRNA. Then describe and explain…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Discuss how RNA is able to achieve complex structures for its function in cells

A: There are different macromolecules present in living organisms. They include carbohydrates, nucleic…

Q: what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR,…

A: Introduction A ribosome reads messenger ribonucleic acid (mRNA), a single-stranded RNA molecule that…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: Describe how proteins are sequenced, and explain why sequence determination is important

A: Protein sequencing is the technique to determine the amino acid sequence of a protein. Proteins are…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.