Determine the pKa of the amino acid using the graph graph attached:
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: 5-6. Choose the best answer from the following questions and provide a one paragraph explanation for…
A: RBCs transfer oxygen from the lungs to the rest of the body's cells. This oxygen is needed to…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: Mitochondria are considered to be the powerhouses of eukaryotic cells because they produce ATP,…
A: Citric acid cycle metabolizes acetyl-coA derived from glucose. Fermentation of lactic acid produces…
Q: Enzyme X and Enzyme Y both react with the same substrate S. In each reaction with S, 10 µM enzyme is…
A: A substance called an enzyme acts upon a substrate molecule and reduces the amount of activation…
Q: What is the approximate temperature (in both F° and C°) for enzyme activity in the human body?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: Which of the following statements is correct about oxidative pentose phosphate pathway? Group of…
A: Oxidative pentose phosphate pathway: . This is the first phase in pentose phosphate pathway in which…
Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct? A.…
A: DNA : Double helix A: Adenine G: Guanine T: Thymine C : Cytosine
Q: [S] Vo vo with I 0.00 0.00 0.00 1. 15 2. 14 0. 60 0. 25 0. 50 1. 15 2. 14 3. 75 6. 00 8. 57 1.00…
A: The plot is given in step 2
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: What is another name for the glycolate pathway?
A: The process of respiration that is initiated in the chloroplast and take place only during day is…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: Concentration Substrate/Cofactor (nM)
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. coenzyme b.…
A: Enzymes are proteins that involved in metabolic function by speeding up the chemical reaction.
Q: What kind of quality assessment is performed on amylase and why is this important? 2. What are the…
A: Amylase comes under the glycoside hydrolase enzyme family that break down starch into glucose…
Q: With the aid of diagrams, describe how the body’s adaptive immune system responds to an infection.
A: Memory cells (B- and T-lymphocytes) are white blood cells that keep track of every germ the immune…
Q: What is the RBC metabolism? How it is connected with the Embden-Meyerhof Pathway?
A: Erythrocytes, often known as RBCs, are a kind of blood cell that is produced in the bone marrow and…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Retroviruses are viruses with an enzyme known as reverse transcriptase. Transcription is the process…
Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…
A: Digitoxin is a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Q: Bigger size sample would result to better quality spectra compared to smaller sample with small size…
A: Attenuated Total Reflection - Fourier Transform Infrared Spectroscopy is a technique to study the…
Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…
A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: You are working in a factory that is producing chemicals from the bacterium Corynebacterium…
A: Corynebacterium glutamicum is a facultative anaerobic gram-positive, catalase-positive, rod-shaped…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: Mutations in enzymes of the metabolic pathways are called inborn errors in metabolism.
Q: Biological relationship between hydrogen peroxide and catalase?
A: Reactive oxygen species (ROS) are generated due to the partial reduction of oxygen in the electron…
Q: (Q21) A certain protein has a Ką value 107 M1 and other has a K, value of 10° M1. Of two proteins,…
A: Proteins are composed of a linear chain of amino acid sequences attached together via peptide bonds.…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: During replication forks, Okazaki fragments are transient components of lagging strand DNA…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…
A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: How does compromised pyruvate kinase activity lead to anemia? (3 sentences)
A: Pyruvate kinase is a glycolysis enzyme that plays a role in the last phase. It catalyzes the…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: Explain the mechanism of Warburg effect and how it benefits cancer cells
A: Cancer means uncontrolled cell growth. This uncontrolled cell growth may cause a lump of cell or…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate of the…
A: The hexose monophosphate shunt, also known as the pentose phosphate pathway, is a shunt from…
Q: A man just ate a plant-based hamburger with a bun and nothing else on the sandwich.Coincidentally,…
A: As man ate plant-based hamburger with a bun. Plant based hamburger is made up basically from…
Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.
A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…
Determine the pKa of the amino acid using the graph graph attached:
Step by step
Solved in 2 steps
- Determine the maximum velocity of the uninhibited reaction at 30 °CA 50-year-old man came to the emergency department after returning from foreign travel. His symptoms included persistent diarrhea (over the past 3 days) and rapid respiration (tachypnea). Blood gases were drawn with the following results: pH 7.21 pco2 19 mm Hg po2 96 mm Hg HCO3 − 7 mmol/L SO2 96% (calculated) (reference range, >95%) Why is the HCO3 − level so low? Why does the patient have rapid respiration?A 50-year-old man came to the emergency department after returning from foreign travel. His symptoms included persistent diarrhea (over the past 3 days) and rapid respiration (tachypnea). Blood gases were drawn with the following results: pH 7.21 pco2 19 mm Hg po2 96 mm Hg HCO3 − 7 mmol/L SO2 96% (calculated) (reference range, >95%) What is the patient’s acid–base status? Why is the HCO3 − level so low? Why does the patient have rapid respiration? *Kindly answer all questions. Thank you
- A 50-year-old man came to the emergency department after returning from foreign travel. His symptoms included persistent diarrhea (over the past 3 days) and rapid respiration (tachypnea). Blood gases were drawn with the following results: pH 7.21 pco2 19 mm Hg po2 96 mm Hg HCO3 − 7 mmol/L SO2 96% (calculated) (reference range, >95%) What is the patient’s acid–base status? Why is the HCO3 − level so low? Why does the patient have rapid respiration?A 26 year old female with hypokalaemia is prescribed an intravenous infusion of 0.15% potassium chloride (KCl) to correct this imbalance. She is to receive 50 mL 0.15% KCl over 6 hours. (0.15% KCl contains 20 mmol KCl per litre) How much potassium (in mmol/hour) is the patient receiving? units -mmol/hrA 50-year-old man came to the emergency department after returning from foreign travel. His symptoms included persistent diarrhea (over the past 3 days) and rapid respiration (tachypnea). Blood gases were drawn with the following results: pH 7.21 pco2 19 mm Hg po2 96 mm Hg HCO3 − 7 mmol/L SO2 96% (calculated) (reference range, >95%) Question: What is the patient’s acid–base status? Why is the HCO3 − level so low? Why does the patient have rapid respiration?
- Mechanically ventilated patient has pH of 7.54, PaCO2 of 26 torr, and HCO3 of 22 mEq/L. Calculate the patient's PaCO2 to level that will decrease pH to 7.45 .A nurse has a patient who she suspects might have long term respiratory acidosis. Which of the following pieces of information would support her suspicion? 1.An acidic pH and a decrease in Pco2 2. An alkaline (or basic) pH and an increase in Pco2 3. An acidic pH and an increase in Pco2 4. Hyperventilation 5. Hypoventilation 6. Increased plasma HCO3 7. Decreased plasma HCO3 O 1,4, 6 O 2, 5, 6 O 3, 5, 6 O 1, 5, 7 O 3, 4, 6A patient suffers from hypokalaemia, and is prescribed an intravenous infusion of 0.15% potassium chloride (KCl) to correct this imbalance. She is to receive 50 mL 0.15% KCl over 4 hours. How many mmol/hour of potassium is she receiving? (0.15% KCl contains 20 mmol potassium per litre)