d. Name some official antibacterial agents and give their mechanism of action. (Topical agents)

Q: The small circular pieces of DNA that can be transferred into bacteria are called

A: DNA is the hereditary material present in human beings and most other organisms. It is a molecule…

Q: In eukaryotic cells, __________ copying initiates nearlysimultaneously at thousands of origins of…

A: The origin of replication refers to the specific sequence present in the genome that triggers the…

Q: DNA contains phosphorus whereas protein does not. Protein contains sulfur whereas DNA does not.…

A: Answer. Alfred Hershey and Martha Chase   Alfred Hershey and Martha Chase in the years 1951 and…

Q: Match the definitions and key words with the group name (programmed or stochastic). From the drop…

A: 1. The cellular aging theory suggests that the lifespan of a species is limited by an internal…

Q: The bacterial chromosome is a ring of____________-stranded DNA.

A: DNA is the source of genetic information that flows from generation to generation. DNA molecules are…

Q: Question 33 A presumptive test is a test that is performed to verify that a substance is present.…

A: Test is used to find the presence or absence of substance in the sample.

Q: Please answer fast A scientist used the identifiler PCR kit on a sample from crime scene. He got…

A: Forensic Scientist got no amplification in case of negative control here. So, the PCR stock is good…

Q: If DNA polymerase makes an error during copying it creates a ________ in the DNA.

A: Question - If DNA polymerase makes an error during copying it creates a ________ in the DNA.

Q: Question 64 The vertebrates that lack jaws are called O rays. O turtles. O lampreys. O eels. MacBook…

A: Since you have asked multiple questions from different topics at a same time we will answer only 1st…

Q: A BIO101 student says, "Dr. Lopes spend all our time talking about DNA, but that's silly because DNA…

A: DNA and RNA are the genetic material. These carry the information from one generation to another.…

Q: Any change in the sequence of DNA is called as O 1. transcription O 2. mitosis 3. mutation 4.…

A: well, any change in the sequence of DNA is called mutation. But for a much clearer concept, i would…

Q: The fundamental unit of heredity is the ___________.

A: Passing down the genetic material by the parents to their next generation is known as heredity. It…

Q: how to extract DNA from everything

A: Extraction of DNA from a specimen is a process by which nuclear DNA can be extracted from the cell…

Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…

Q: QUESTION 10 When using an organism's taxonomic name, scientists usually abbreviate by using just…

A: Homo modernus - The Homo modernus (modern man) was born some time in the 780s  Homo ferox means…

Q: DNA fingerprinting.

A: A genetically modified virus is a virus that has been altered or generated using biotechnology…

Q: QUESTION 1 RNA Polymerase is the enzyme responsible for DNA replication True False

A: Question 1 =DNA polymerase is the enzyme responsible for DNA replication while RNA polymerase is the…