Current models for the origin of genetic information flow regard which of the following processes as probably the last one to evolve (under natural conditions in the history of life)? direct translation of proteins from a DNA template self-replication of RNA from an RNA template transcription of RNA from a DNA template translation of proteins from an RNA template reverse transcription of DNA from an RNA template

Q: Please help Why did we use nanoparticles?

A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…

Q: Which of the following mobile genetic elements is a retrotransposon, making up about 15% of the…

A: A transposon  may be a nucleic acid sequence which will modify its position among a genome,…

Q: In this diagram, the position marked "A" corresponds to the end of a new RNA molecule (shown in…

A: DNA The long chain of nucleoids that found in the nucleus of the cell and carry genetic information.

Q: Example: Beyonce has brown eyes. Her eyes look brown because her DNA codes for a brown pigment in…

A: The central dogma of molecular biology illustrates the flow of genetic information in a cell. The…

Q: Which of the following statements regarding DNA synthesis at the ends of linear chromosomes i Eruel…

A: DNA is a double helical structure and is the genetic material in almost all organisms. DNA…

Q: Please read the scenario below and then answer the question (in bold) that follows. An original DNA…

A: The original DNA sequence is  3'-GGCGCTAGAATC-5'. A mutated version of that DNA strand is…

Q: A mutation occurs that changes a codon from UCC to UCA. It turns out that this codon is for an amino…

A: Based on the nature of change that occurs in a codon due to a point mutation (mutation at a single…

Q: Which of the following statements is true about consensus sequences in DNA? Group of answer choices…

A: Short nucleotide segments which recur often in conserved sequences are known as consensus sequences.…

Q: Short DNA sequence having single occurrence in genome isa) Expressed sequence tagb) Sequence tagged…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Exon shuffling can readily produce new functional genes because it:     Converts exons into…

A: Exon shuffling is a molecular mechanism that may cause the evolution of new genes. It involves the…

Q: Current models for the origin of genetic information flow regard which of the following processes as…

A: Molecular biology is the biology that deals with the structure and function of macromolecules such…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Considering the proclivity of bacteria to share genetic information, discuss the concerns behind…

A: Mainly antibiotics are implicated against bacterial infections. Such as in common strep throat the…

Q: Describe how alterations in bacterial genes can be beneficial and harmful to humans. Include ONE…

A: Bacterial DNA is the genetic material that makes up bacterial cells. It contains all of the…

Q: Suppose that a rare DNA replication error results in the duplication of a single gene, giving the…

A: DNA replication is the process by which the genome’s DNA is copied in cells. Before a cell divides,…

Q: The diagram below shows a hybridization experiment between a eukaryotic MRNA and the template strand…

A: It was performed using both the cytoplasmic RNA (ribonucleic acid) and nuclear pre-mRNA (messenger…

Q: The words “transcribe” and “translate” are more commonly associated with language and dialogue. For…

A: Molecular biology is the biology that deals with structure and function of macro molecules such as…

Q: Which of the following contribute to introducing genetic change into genomes? (select all the apply)…

A: The objective of the question is to identify the processes that can introduce genetic change into…

Q: A scientist observing a cell during gene expression would be able to easily distinguish it as a…

A: Answer-- option 1-  0 The genotype of II-5 will be ww.

Q: DNA footprinting is a technique that can be used to identify: A region of DNA that has been damaged…

A: DNA footprinting is a technique that is used to identify or recognise the interaction between DNA…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…

A: Gel electrophoresis refers to the separation technique that involves the separation of charged…

Q: RNA-dependent RNA polymerase performs which of the following functions? O 1) Uncoats the viral…

A: Various different kinds of enzymes are involved in the replication, transcription, and translation…

Q: Which of the following mobile genetic elements is a retrotransposon, making up about 10% of the…

A: A transposon can be defined as the characteristic mobile genetic element. These elements can…

Q: The RNA polymerase is only using one strand of DNA as a template, and only transcribes specific…

A: Introduction: DNA, also known as deoxyribonucleic acid, is the genetic material present in humans…

Q: In the closed promoter complex Select an answer and submit. For keyboard navigation, use the up/down…

A: Transcription is a multistep process that starts when RNA polymerase holoenzyme binds to DNA. RNA…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.