coli, mak you believe will grow faster (37° C or 30° C temperature) and why. Results• Time Absorbance 30 °C Absorbance 37 °C Generation time Generation time t=0 min at 30 °C at 37 °C 0.05 0.05 t= 20 min 0.06 0.07 t= 40 min %3D 0.1 0.16 0.28 0.21 0.44 t = 60 min t= 80 min %3D 0.95 Complete the graph. Make sure this figure has a description and all other labels are included. Once you have completed graphing the points, draw a best-fit line for each of your data sets by eye Questions: 1. Which data point can be the first to be considered in log phase for each line? (It will be the first point that seems to be described by your best-fit line.) For the 30° C culture the -minute point is the first one likely to be in log phase. For the 37° C culture the -minute point is the first one likely to be in log phase. Incubation Temperatures - Growth Bio 40- Fall 2019 Page 6

coli, mak you believe will grow faster (37° C or 30° C temperature) and why. Results• Time Absorbance 30 °C Absorbance 37 °C Generation time Generation time t=0 min at 30 °C at 37 °C 0.05 0.05 t= 20 min 0.06 0.07 t= 40 min %3D 0.1 0.16 0.28 0.21 0.44 t = 60 min t= 80 min %3D 0.95 Complete the graph. Make sure this figure has a description and all other labels are included. Once you have completed graphing the points, draw a best-fit line for each of your data sets by eye Questions: 1. Which data point can be the first to be considered in log phase for each line? (It will be the first point that seems to be described by your best-fit line.) For the 30° C culture the -minute point is the first one likely to be in log phase. For the 37° C culture the -minute point is the first one likely to be in log phase. Incubation Temperatures - Growth Bio 40- Fall 2019 Page 6

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Yeast cells were incubated with and without glucose at three different temperatures for four minutes, during which the rate of CO2 production was measured with a CO2 sensor. What conclusions can be drawn from the results of the experiment?
. The photosynthetic process used by the green sulfur bacteria, under anaerobic conditions, is best represented by which of the following balanced equations? 6CO2 + 12H2S g C6H12O6 + 6S2 + 6H2O C6H12O6 + C6H12O6 g C12H22O11 + H2O 6CO2 + 12H2O g C6H12O6 + 6O2 + 6H2O C12H22O11 + H2O g C6H12O6 + C6H12O6 C6H12O6 + 6O2 + 6H2O g 6CO2 + 12H2O
To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is typically used. The yield overline v is defined as Y = (X - X_{0}) / (S_{0} - S) Where X and S are the cell mass and substrate concentration at any time t and X_{0} and S_{0} are the initial cell mass and substrate concentration. Assume that your cells spend a time tl in the lag phase, and then transition to the exponential phase. Calculate the concentration of the substrate S, at any time point t in the reactor Use Monod equation in the exponential phase to relate mu net to mu max . Your final answer should only contain S. S_{0} X_{0} t, mu max and K_{s}
add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…
idenify the results sown in the image
Explain the advantages and disadvantages of Differential Centrifugation, main differences btw. Differential and Gradient Density Centrifugation and why the differential Centrifugation is a process of successive centrifugation?
Table 3-Determination Tube # Potato Expt. Temp. 2c 3c 4c 5c extract (mL) 2 2 2 2 room temp 20 °C 40 °C 75 °C of the optimum temperature of catechol oxidase enzyme. 1st Absorbance 0 min. at Expt. Temp. Boiling 100 °C dH₂O Catechol (mL) (mL) 0 0 0 0 13 13 13 13 Start Time: 4:20 Absorbance: 0.072 Start Time: 4:25 Absorbance: 0.114 Start Time: Absorbance: 25 0.132 Start Time: 4:27 Absorbance: 0.097 2nd Absorbance after 10 min. in Expt Temp. Time for reading: 4:30 Absorbance: 0.128 Time for reading: 4:33 Absorbance: 0.036 0-137 Time for reading: 4:35 Absorbance: Subtract 1st from 2nd absorbance 0.193 Time for reading: 4:37 Absorbance: 0-126 0.023 0.061 0.029 Based on the data from Table 2 answer these questions: Q10) What is the enzyme's optimum temperature? Answer: Q11) Use the difference between 2nd and 1st absorbance to support your conclusion for the optimum temperature 3rd Absorbance after 10 more min. at Room Temp. Time for reading: 4:40 Absorbance: 0.159 Time for reading: 4:43…