Answered: Choose an expression for the…

Choose an expression for the equilibrium constant (Kc) for the following chemical equation: 2K2O2 (s) +2CO2 (g) 2K2CO3 (s) + O2 (g) [K,CO3J°[O2] O K. O K. [02] K. [K2CO3]*[O2] [02] K. [CO2]?

Principles of Modern Chemistry

8th Edition

ISBN:9781305079113

Author:David W. Oxtoby, H. Pat Gillis, Laurie J. Butler

Publisher:David W. Oxtoby, H. Pat Gillis, Laurie J. Butler

Chapter14: Chemical Equilibrium

Section: Chapter Questions

Problem 16P

See similar textbooks

Related questions

Q: Example 3 A sample of zinc anode corrodes uniformly with a current density of 4.27 x 107 A/cm² aqueo...

A: Step = 1st Solution The following reaction: Zn→ Zn 2+ + 2e Corrosion Rate = (...

Q: H3CHN A H2N H3CO- O- ENH H3COCH2CH2C CH2CH2CH2OH E H3CH2CH2CH2C CH2CH,COOH OH

A: 39. If each doubly bonded carbon atom in a compound is attached to different atoms/groups, 'E-Z' nom...

Q: Estimate the λmax of the following organic compounds. Show your solutions and/or analysis.

Q: Which statement is correct? I. The carbons in a chair conformation will have two axial or two equato...

Q: Under certain conditions the rate of this reaction is zero order in hydrogen iodide with a rate cons...

A: A zero order reaction is the independent of the reactant concentration. And formula used [A]t = - k...

Q: the formation of or row is used to rep

Q: The activation energy for a certain reaction is -164 kJ/mol. If the rate constant is 117 M-1 s-1 at...

Q: Write the balanced NET IONIC equation for the reaction that occurs when hydroiodic acid and potassiu...

Q: A compound is found to contain 37.32 % phosphorus, 16.88 % nitrogen, and 45.79 % fluorine by mass. W...

A: Empirical formula of a compound can be defined as the simplest whole number ratio of atoms present ...

Q: 4. a. One liquid has a temperature of 140°F and another liquid has a temperature of 60°C. Are the li...

A: Temperature of first liquid = 140°F Temperature of second liquid = 60°C

Q: Molecule(s) to Make Make the product of the reaction between formaldehyde and methanol glyceraldehyd...

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for yo...

Q: Calculate the (a) Linearity constant (r), (b) y-intercept, (c) Slope, and (d) Protein content of an ...

A: Given

Q: A 225.0 mL sample of 0.10 M Sr(OH)2 is titrated with 0.10 M HI. Determine the pH of the solution aft...

Q: Describe main features of the evidence of M-CºC characterization and corresponding techniques of thi...

A: answer :

Q: An aqueous solution contains 0.26 g of an organic compound in 1 L of solution. The osmotic pressure ...

A: a) Given, Mass of the organic compound (m) = 0.26 g Volume of the solution (V) = ? Osmotic pressure ...

Q: If 58 moles of NH 3 are combined with 32 moles of sulfuric acid, what is the limiting reactant and h...

A: Complete solution is given below in next step

Q: A protein binds a ligand with a KD value of 0.25 M. If you are at a ligand concentration of 0.63 M, ...

A: Fraction of the protein that bound at given ligand concentration is given by: ...

Q: This is the excessive bending of bonds exhibited by a carbons at the point of rotation which creates...

A: Strain arises due to the repulsion between the bond electron of the molecule . So the molecule are a...

Q: NBS CCI4

Q: Which of the following is not a characteristic of a genetic code? a. reading of codons does not inv...

A: a. reading of codons does not involve any overlap This statement is correct.

Q: The structures Pentan-2-one and Pentan-3-one are isomers. A Positional B Stereoisomers Functional Sk...

A: Answer :

Q: 7. Consider the crystallization of sulfanilamide from 95% ethyl alcohol. If impure sulfanilamide is ...

A: Concept:-

Q: 2. Balance the REDOX reaction belk

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: Supposing compound A is 2-methylbutane-2,3-diol and compound B is n-pentane. Compound A is more solu...

A: Water is a polar solvent and it can dissolve an ionic or polar covalent compound. The solubility of ...

Q: NH3: S= 193; H = -46.3 %3D HCl: S=187; H= -92.3

A: The reaction which are spontaneous is given below

Q: Draw (be specific on the structures of each component in the cycle) and explain the entire process o...

Q: e mole fraction of C2H

Q: Aniline (C6H5NH2), a weak base, is one of the starting materials for the synthesis of organic dyes. ...

A: Given, Aniline (C6H5NH2), a weak base, is one of the starting materials for the synthesis of organic...

Q: Identify the peaks and structer.

A: 13C-NMR shows an non-equivalets of the carbons in the spectrum. The number of signals in the spctrum...

Q: "Vhich of the following compounds will have the highest dens A 2-aminopropane B 2-methylbutane Obuta...

A: Density = Mass /Volume

Q: ow much is left 2.0 s later?

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

Q: Draw the expanded structural formula of an organic compound with sixteen carbons using the following...

Q: Calculate the pH of a solution formed by mixing 120.0 mL of 0.30 M HClO with 1180.0 mL of 0.20 M LiC...

Q: 9 (c) (i) Complete the diagram to show the mechanism of this reaction. Include all necessary charges...

A: This reaction is the nucleophilic addition between acetaldehyde and Sodium cyanide. The product of t...

Q: POSSIBLE NagPO4 + Baclz - Baş(PO42 + Naci How many moles of BaClz are needed to make 2.50 moles of N...

Q: Calculate the concentration equilibrium constant, K’sp for La(IO3)3 in a saturated solution of La(IO...

A: For a sparingly soluble salt, there is a dynamic equilibrium between the dissociated ions and undiss...

Q: Question 2 Choose all of the following that result in a chemical change O when you open a can of sod...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: e reaction

Q: Typical seawater contains 2.7g of salt (sodium chloride, NaCl) per 100mL. What is the molarity of Na...

Q: e boiling point of

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: 18. Provide the major product or products in the boxes below. Be clear about the stereo- and regioch...

A: Let us solve them one by one.

Q: Which of the following species is likely to be a nucleophile and which an electrophile? (a) CH3CI {b...

A: Electrophile is species which loves negative charge and nucleophilehile is species which loves posit...

Q: The solubility of the hydroxide of a hypothetical metal, Me, in water is 131.34 g MeOH per 44.13 mL ...

Q: answers for letter a and b

Q: The equilibrium constant, Ka, for the following reaction is 1.29x10-2 at 600 K. coCI2(g) co(g) + Cl2...

A: The balanced equilibrium reaction given is COCl2 (g) ⇌ CO (g) + Cl2 (g) The equilibrium constant K...

Q: An ionic compound of formula XY2 (X = cation with two positive charges, Y = anion with one negative ...

Q: The pectral data below i8 for a Compaund once OSed as a riot Control agunt, that is no longer due to...

Q: 1) What law is applicable to distillation? 2) When are the following types of distillation used: a) ...

A: Distillation is a separating technique of liquids based on the boiling point differences.

Q: Problem 48 C10H200 Problem 48 - 13C NMR spectrum (CDC13, 125 MHz) MW = 156 34.5 45.0 22.2 23.1 20.1 ...

A: 13C-NMR: 13C-NMR provides information about the types of carbons of unknown. The peaks in the range ...

Question

Choose an expression for the equilibrium constant (Kc) for the following chemical equation:
2K2 O2 (s) + 2CO2(g) = 2K2CO3 (s) + O2 (g)
[K2CO3]°[O2]
Ο Κ.
[K2O2]°[CO2]?
[CO2]?
O K.
[02]
[K2O2J°[CO2]?
O K.
[K2CO3]*[O2]
[O2]
Ko
[CO2]?

Expert Solution

Step 1

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Wet limestone is used to scrub SO2 gas from the exhaust gases of power plants. One possible reaction gives hydrated calcium sulfite: CaCO3(s) + SO2(g) + H2O() CaSO3 H2O(s) + CO2(g) Another reaction gives hydrated calcium sulfate: CaCO3(s) + SO2(g) + H2O() + O2(g) CaSO4 H2O(s) + CO2(g) (a) Which reaction is more product-favored at equilibrium? Use the data in the table below and any other information needed in Appendix L to calculate rG for each reaction at 25 C. (b) Calculate rG for the reaction CaSO3 H2O(s) + O2(g) CaSO4 H2O(s) Is this reaction product- or reactant-favored at equilibrium?
Actually, the carbon in CO2(g) is thermodynamically unstable with respect to the carbon in calcium carbonate(limestone). Verify this by determining the standardGibbs free energy change for the reaction of lime,CaO(s), with CO2(g) to make CaCO3(s).
9.96 Most first aid "cold packs" are based on the endothermic dissolution of ammonium nitrate in water: NH4NO3(s)NH4+(aq)+NO3(aq) H= 25.69 kJ A particular cold pack contains 50.0 g of NH4NO3 and 125.0 g of water. When the pack is squeezed, the NH4NO3dissolves in the water. If the pack and its contents are initially at 24.0°C, what is the lowest temperature that this bag could reach? (Assume that the ammonium nitrate solution has a specific heat of 4.25J g-l K-l, and that the heat capacity of the bag itself is small enough to be neglected.)
Sodium chloride is added to water (at 25C) until it is saturated. Calculate the Cl concentration in such a solution. Species G(kJ/mol) NaCl(s) 384 Na+(aq) 262 Cl(aq) 131
When 7.11 g NH4NO3 is added to 100 mL water, the temperature of the calorimeter contents decreases from 22.1 C to 17.1 C. Assuming that the mixture has the same specific heat as water and a mass of 107 g, calculate the heat q. Is the dissolution of ammonium nitrate exothermic or endothermic?
Write a chemical equation for each process and classify each as reactant-favored or product-favored. (a) A puddle of water evaporates on a summer day. (b) Silicon dioxide (sand) decomposes to the elements Silicon and oxygen. (c) Paper, which is mainly cellulose (C6H10O5)n, bums at a temperature of 451 F. (d) A pinch of sugar dissolves in water at room temperature.
The equilibrium constant for a certain reaction increases by a factor of 6.67 when the temperature is increased from 300.0 K to 350.0 K. Calculate the standard change in enthalpy (H) for this reaction (assuming H is temperature-independent).
Consider the reaction 2N2O(g) + O2(g) 4NO(g) Suppose the system is at equilibrium, and then an additional mole of N2O(g) is injected into the system at constant temperature. Once the reaction reestablishes equilibrium, has the amount of N2O increased or decreased from its original equilibrium amount? Explain. What happens to the value of the equilibrium constant with this change?
When a mixture of hydrogen and bromine is maintained at normal atmospheric pressure and heated above 200. °C in a closed container, the hydrogen and bromine react to form hydrogen bromide and a gas-phase equilibrium is established. Write a balanced chemical equation for the equilibrium reaction. Use bond enthalpies from Table 6.2 ( Sec. 6-6b) to estimate the enthalpy change for the reaction. Based on your answers to parts (a) and (b), which is more important in determining the position of this equilibrium, the entropy effect or the energy effect? In which direction will the equilibrium shift as the temperature increases above 200. °C? Explain. Suppose that the pressure were increased to triple its initial value. In which direction would the equilibrium shift? Why is the equilibrium not established at room temperature?
Describe a nonchemical system that is not in equilibrium, and explain why equilibrium has not been achieved.
Predict whether each of the following processes results in an increase in entropy in the system. (Define reactants and products as the system.) (a) Water vapor condenses to liquid water at 90 C and 1 atm pressure. (b) The exothermic reaction of Na(s) and Cl2(g) forms NaCl(s). (c) The endothermic reaction of H2 and I2 produces an equilibrium mixture of H2(g), I2(g), and HI(g). (d) Solid NaCl dissolves in water forming a saturated solution.
Another step in the metabolism of glucose, which occurs after the formation of glucose6-phosphate, is the conversion of fructose6-phosphate to fructose1,6-bisphosphate(bis meanstwo): Fructose6-phosphate(aq) + H2PO4(aq) fructose l,6-bisphosphate(aq) + H2O() + H+(aq) (a) This reaction has a Gibbs free energy change of +16.7 kJ/mol of fructose6-phosphate. Is it endergonic or exergonic? (b) Write the equation for the formation of 1 mol ADP fromATR for which rG = 30.5 kJ/mol. (c) Couple these two reactions to get an exergonic process;write its overall chemical equation, and calculate theGibbs free energy change.