Choose an animal alive today. Fast forward 12 million years when the Earth is 16.2°F warmer. Your species of animal has survived this temperature increase, but not without some physical

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals.…

Q: Recognize the following types of biomolecules when given images such as the ones below and on the…

A: Biomolecules are carbon-containing organic molecules present inside or synthesized within living…

Q: he β subunit of polymerase has a function of ____________

A: RNA polymerase binds to the promoter region and initiates the transcription. The beta subunit is one…

Q: True/False Question (suggested time - up to 1 minute): The amino acid sequence of a given protein…

A: Mutation is the sudden inheritable change in the genotype. The process by which the mutation is…

Q: A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a…

A: The central dogma of molecular biology posits that information within a living organism flows from…

Q: A/An________protein binds to the exposed end of a polymeric molecule preventing further…

A: ANSWER) Carrier protein A/An Carrier protein protein binds to the exposed end of a polymeric…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Instructions- DO THE GRAPH LABELING THE NUMBERS AND LABELING THE POINTS AND PLEASE DO THEM ON THIS…

A: The experiment is conducted by taking various variables like independent variables, dependent…

Q: 5'--AUG UCG UAC ACU GCG --3' Make a change in this sequence. Write a different version of this…

A: Given  mRNA sequence  5' AUG UCG UAC ACU GCG 3'   Mutation  The sequencial change in the nucleotide…

Q: 5. What is Bacteriophage typing?

A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…

Q: dentify the following structures, please label your answers with the corresponding number and be…

A: Question  72) Reissner's membrane  73) Tectorial membrane  74) Outer hair cells

Q: The amount of energy available to do work is called

A:

Q: The process to find limit resolution.

A: Given: The process to find limit resolution.

Q: True or False. Nonhomologous endjoining usually alters the DNA by deletions or insertions.

A: introduction :  Chromosomes that do not come from the same pair are referred to as non-homologous…

Q: What is the optimal temperature for the enzyme shown above?

A: Optimal temperature is the point at which enzyme shows maximum activity. If the temperature is too…

Q: DNA _____________ are enzymes that prevent tangling of DNA strands during DNA replication.

A: Topoisomerases is a class of enzymes that reduce supercoiling in DNA by breaking and rejoining one…

Q: Chapter 5 Improving Flexibility The following are the videos you will need to watch for Chapter 5.…

A: The video is all about stretching and knowledge of muscles. This gives a message that before…

Q: Explain in very detailed information, the most common signs and symptoms of PCOS syndrome.

A: Stein-Leventhal syndrome is another name for the polycystic ovarian syndrome (PCOS). It is a…

Q: How yeast produces natural rare molecules (method)

A: Yeast  are fungi ,which are unicellular in nature. Saccharomyces cerevisiae is the scientific name…

Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…

A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…

Q: There are four different type of nucleic acids which may be strung together to make DNA. These four…

A: There are four different biomolecules are present in nature, they are carbohydrates, protein, lipid,…

Q: c) Compare the sensitivity and accuracy of glucose meter with a spectrophotometer. d) Elaborate the…

A: Glucose meter are being utilized for the management of hyperglycemia and hypoglycemia. The…

Q: The sugar in a nucleotide of DNA is __________

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Genetically modified Canola (describe, who was the scientist and when was it created, how is it…

A: Genetically modified (GM) foods are food products produced by genetically altered or modified…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: "If a DNA molecule has 12% thymine, how much guanine will it have?" 12% 24% 38% 76%

A: Chargaff rule: According to this rule in a DNA molecule, the base pairing is complementary and it…

Q: Most liquid-soluble hormones, such as estradiol and testosterone are steroid hormones, made from…

A: Introduction: Hormones are chemical messengers produced by various endocrine glands and tissues in…

Q: _____________ are the linear sequences of nucleotides in an organism’s genetic information.

A: Cell possess genetic information inside the nucleus in the form of DNA as well as RNA, which act as…

Q: Occluding junction is serves as a channels for communication between adjacent cells. O False O True

A: Cell junctions are structures created by a few different transmembrane proteins, whose principal…

Q: Question Completion Status: AMoving to another question will save this response. Question 35 If a…

A: DNA contains 4 nucleotides bases: Adenine Guanine Thymine Cytosine The Adenine binds with Thymine by…

Q: The following are specimens kept in an herbarium except lichens attached on bark of trees…

A: It is a multiple choie question.

Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome

A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…

Q: an example of a relaxation strategy for pain relief?

A: Pain is an unpleasant experience in the human body. It affects the nervous system. Pain is caused…

Q: Please describe what is wrong with the mechanism (First part) in 280 characters or less

A: Aspartic proteases are a family of enzymes that cleave peptide bonds in proteins by using two…

Q: Known mutations of the gene

A: Mutations that are harmful to the body can result in genetic disorders or cancer. A disease caused…

Q: Some plant substances that act as pesticides are psychoactive in humans because: insects have…

A: Some plants produce psychoactive substances, are naturally occurring substances that affect brain…

Q: _____________ is a mechanism that removes and replaces individual nucleotides in DNA when bases have…

A: There are 3 main DNA repairing mechanisms:  - Base excision Nucleotide excision Mismatch repair

Q: DNA is a __________ which is made up of nucleotides

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Zero tb scedule in yogyakarta for june 2024 pls search in webb

A: Here's a further elaboration and discussion for you to easily comprehend and understand the…

Q: uestions 8 and 9 only !

A: A drug which is taken in the body via any route must cross several semipermeable cell membranes…

Q: Would love a list of different types of nucleotide repeat disorders.

A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…