Calculate the pH at the equivalence point in titration 0.100 M solutions of each of the following with 0.080 M NaOH: a. hydrobromic acid (HBr) b. chlorous acid (HClO2) c. benzoic acid (C6H5COOH)

Q: For a reaction Keq = 17.4 × 10-5 at T = 325 K. What is ΔG° for the reaction?

A: Thank you.

Q: O Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…

A: Given:…

Q: 15. What is the pKb of CN-, the conjugate base of HCN? 228 a. 10.40 b. 4.60 по ai.VI noitesu ni ODH…

A: CN- is the conjugate base of HCN because HCN can donate a proton (H+) to become CN-.pKb is the…

Q: A 5.00 L closed vessel contains a mixture of 2.00 mol of O2 and 5.00 mol of N2 at 300 K. What is the…

A: Step 1: SolutionGiven,Pressure(P) = ? ( we need to calculate) Volume(V) = 5.00 L mole(n) = ( 2.00…

Q: Identify the reagents you would use to perform the following transformation: ii-i OH The…

A: Thank you.

Q: (D)The best route to synthesise aromatic primary amines is by reduction of the corresponding nitro…

A: Preparation of p-ToluidineThe reaction scheme for the preparation of p-toluidine (4-methylaniline)…

Q: How many mL of 0.665 M sulfuric acid solution are required to completely neutralize 48.50 mL of…

A: Reaction involved is :-H2SO4(aq) + 2NaOH(aq) -> Na2SO4(aq) + 2H2O(l)From above reaction we know 1…

Q: None

A: Step 1: Step 2: Step 3: Step 4:

Q: For each of the molecules or ions in the chart, do the following • Draw the shape predicted by VSEPR…

A: For CO32-, it has no dipole moment, because all Oxygen atoms are pulling electron density towards…

Q: 3) A chemist tried the following reaction, but did not make the compound she expected. What did she…

A:

Q: E = Cu(s) + 2 Ag+(aq) = Cu² +(aq) + 2 Ag(s) [Cu2+] = 0.025 M [Ag+] = 0.025 M V The cell is not…

A: Given: T=298.15K;[Ag+]=0.025M;[Cu2+]=0.025MCu(s)​+2Ag(aq)+​→Cu(aq)2+​+2Ag(s)​ Step 1: Write the…

Q: Lysine's R group is: ___NH2 If lysine is found at a physiological pH = 7.4, what will its structure…

A:

Q: :$;);););):):$;$;

A: Step 1:Since the allylic or benzylic radical intermediates are more stable than non-conjugated C…

Q: Show the synthesis of the following using intramolecular reaction (ring closing):

A: Step 1: (c)(i) Intramolecular Friedel Craft alkylation(ii) Allylic bromination(iii) Reduction(iv) E2…

Q: dont provide handwriting solution ..

A:

Q: Show steps how to get the amount of error (Pduration - Pmarket) for second question in the picture,…

A: Answer to 9b-20:b. -$0.75Here's why:Duration: We don't need the exact duration value for this…

Q: What would be the final products for the reaction shown below? provide the complete mechanism for…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: Draw the structure of the two products.

A: Step 1: Step 2: Step 3: Step 4:

Q: + STARTING AMOUNT X A solid 30.2 cm³ block of KCIO 3 is heated in the laboratory and decomposes…

A: Step 1: First, let's find the mass of the KCIO₃ block:Mass = Density × VolumeMass = 2.34 g/cm³ ×…

Q: The type your answer... type your answer... of a solution is a measure of the concentration of ions…

A: Ionic Strength (I):Reflects the total concentration of dissolved ions in a solution.Accounts for the…

Q: Gold is frequently purified by electroplating. Typically the gold is dissolved in a cyanide solution…

A:

Q: 7. Use the table of standard cell potentials to find AG° and calculate Kea for the following…

A: 7a. Given: T=298.15KAg(aq)+​+Fe(aq)2+​→Ag(s)​+Fe(aq)3+​Step 1: Write the equations we need to…

Q: Using the blank graph space below, draw an energy diagram/profile for a reaction that includes the…

A:

Q: An atomic absorption spectroscopy analysis provided the following data for the analysis of Cu in a…

A: Step 1:Absorbance is the dependent variable; it is placed on y-axis.Concentration is independent…

Q: please answer in text form and in proper format answer with must explanation , calculation for each…

A: Recall that the Van't Hoff equation is expressed as follows: lnK=−R△H0​T1​+R△S0​ When constructing a…

Q: name of this compound????

A: In case of any doubt please feel free to ask.

Q: Calculate the molar mass of air with classical composition (given in volume percent): 78.09% N2,…

A: So, the molar mass of air with classical composition is approximately 28.94 g/mol, and the molar…

Q: Calculate the expected mass of calcium sulfate: Na2SO4 + CaCl2 -> CaSO4 + 2 NaCl 142 g (Molar Mass)…

A: since data of reactant is not given let me give you brief idea assuming you have data. Na2SO4 +…

Q: Complete the electron configuration diagram below for a neutral Sb atom. 7p 6d 5f 7s 65 Increasing…

A: The atomic number of Sb = 51                       ( reference:periodic table)Therefore,Number of…

Q: Indicate the major product of the reaction, drawing the intermediate products if any.…

A: Step 1: Knoevenagel Reaction: This a reaction where an active hydrogen compound undergoes…

Q: None

A: Step 1:1−chloro−2,4−dinitrobenzene is a aromatic compound which a chlorine atom and two nitro group…

Q: Please Give Step by Step solution Otherwise give you DISLIKES !!

A:

Q: Please Write SteP by Step Answer Otherwise I give you DISLIKES !

A: Let me provide a more detailed explanation of the step-by-step process for the formation of J from…

Q: None

A: Reduction reaction of aldehyde and ketone with NaBH4 yields primary alcohols as the major product…

Q: Consider the E1 elimination products. Draw the minor product. Br Ꭰ H₂O

A: The major product is the Zaitsev product in which most substituted alkene is formed by eliminatin  a…

Q: Write two half-reactions to describe each of these metal displacement reactions. Include phase…

A:

Q: What would be the major product(s) of the following reaction? །། Brtw HO 20°C (CH3)2CHCH20 I…

A: Tertiary alkyl halide in the presence of alcohol will either undergo SN1 (nucleophilic substitution…

Q: Please don't provide handwritten solution .....

A: Step 1:Aldol reaction:-Aldol reaction combines two carbonyl compounds by making a C-C bond. This…

Q: Please don't provide handwritten solution ....

A: Hydrolysis reaction definitionIn a hydrolysis reaction, the water is used to break down the chemical…

Q: convert 6.27 mol of hydrogen peroxide into mass (in grams)

A:

Q: QUESTION 7 Provide a reasonable synthesis to produce the compound shown below. Draw the structure of…

A: Detailed explanation:Key references:Compound of Carbon Atoms.

Q: Predict the major organic product(s) of the reaction shown below. OH A only B only C only H₂O - ? OH…

A: The major product will be A because addition of -OH takes place according to Markonikov's…

Q: The height of a canister is 90 cm, the large diameter is 65 cm, and the small diameter is 45 cm. And…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…

Q: Stoichiometry Record the mass of the empty beaker 103.05g Record the mass of sodium sulfate used…

A: Step 1:Step 2:Percent yield≈84.96%Therefore, the percent yield of calcium sulfate is approximately…

Q: A reaction was shown to follow second-order kinetics. How much time is required for [A] to change…

A:

Q: Question 7 Which of these coenzymes is required for the following reaction? NH3 HS A.…

A: The reaction shown in the image is a transformation of a thiol group (-SH) into a thiol ester,…

Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…

A: If the concentration of a reaction species is increased (at constant T and V), the equilibrium…

Q: A 3.0-kg cast iron pan absorbs 1.08 × 105 J of energy as its temperature rises from 20°C to 100°C.…

A: Let's answer each question one by one:Specific Heat Capacity of Cast Iron:We can use the formula…

Q: 0000 What major product (from Figure #1) results from the following reaction (from Reaction #1)?…

A: Step 1:Correct answer is B) Compound B 1. Initial reaction with pyridine  Pyridine acts as a base,…