C++ First, read in an input value for variable inCount. Then, read inCount integers from input and output each integer on a newline after the string "read-". Ex: If the input is 2 45 55, the output is: read-45 read-55
Q: // JumpinJava.cpp - This program looks up and prints the names and prices of coffee orders. //…
A: Answer: Note: Two possible solutions are provided as no output or output format was specified,…
Q: Please fill in the blanks for C /* Print full name*/ #include #include __1__…
A: For the scan_name function: Since isDone variable is of the boolean type (1)->bool Also…
Q: The function is named "promptLoyola," and it has the following prototype. // This function will…
A: Required function is implemented below
Q: C++ Write a program that first asks the user to enter a string and then asks the user to enter a…
A: Below is required C++ Code. Approach of Program: Include necessary header files and use namespace…
Q: in c++ Write a program to generate a random number between 1 - 100, and then display which quartile…
A: This question explains about C++ program Program Guidelines: Utilize the header records,…
Q: Define the Datatype Your floating-point number should include two fields: mantissa, which is a…
A: The answer is provided below.
Q: ou are required to write three overloaded functions called stringOperation that take in the…
A: Solution: The required 3 functions are given below with the main function as well for…
Q: #include #include using namespace std; int main() { // Declare variables. string…
A: #include <iostream> #include <string> using namespace std; int main() { // Declare…
Q: cstrings.cpp 1 #include using namespace std; 3 bool empty(const char* s) 4 { 5 6 7 8 }
A: bool empty(const char* s){ length = 0; while (input string is not finished) length++;…
Q: C++ beginner class practice problem Please put //comments in so I understand the program Consider…
A: Required C++ code given below:
Q: /* Program Name: BadDate.cpp Function: This program determines if a date entered by the user is…
A: Required C++ code according to sample code provided given below :
Q: the Tacter C appears m the C-string s. You cannot use any of the library functions from .…
A: #include<iostream> using namespace std; int countChar(const char* s,char c) { int count=0;…
Q: Write code to read a list of song durations and song names from input. For each line of input, set…
A: Please find the answer below :
Q: Integer variable numMinutes is read from input. Type cast numMinutes to a double. Ex: If the input…
A: Here is your solution -
Q: n c++ add the request for the month number and read it in, add the request for the year and read it…
A: According to the Question below the Solution: Output:
Q: this is what i have #include #include using namespace std; /* Define your functions here. */…
A: I have implemented the PrintMenu() and ExecuteMenu() as per the given description..
Q: C++ It keeps telling me build fail when i run it. Please help me find the mistakes. .....…
A: Explanation: You’re using the “foundwordPos” without any purpose while generating "wordStr" .…
Q: Now, modify it to do the following: Modify the while loop to utilize tolower() or toupper(). Add…
A: So for first we will use tolower. tolower(A) changes A to a. So even if we enter Y or N, it will be…
Q: #include using namespace std; int main() { // write your code here. return 0;
A: I have provided C++ CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT-----------------
Q: P| Understanding if Statements In this lab, you complete a prewritten C++ program for a carpenter…
A: Given: // HouseSign.cpp - This program calculates prices for custom made signs. #include…
Q: s as indicated by the comments. na directory of your choice, and then make th le Calculator.cpp.
A: Complete c++ code: #include <iostream>#include <string>using namespace std; // Write…
Q: #include #include #include #include #include #include "CommonName.h" #include "Name.h"…
A: Introduction C++ Class: The fundamental unit of Object-Oriented programming in C++ is a class. It's…
Q: #include #include using namespace std; int main() { char s1[50],s2[50]; int…
A: Objective: A program is given to read two strings from the user and join them. The program should be…
Q: C++ part 4: I have these error i am missing the ExecuteMenu Function This is my code so far.…
A: Given: C++ part 4: I have these error i am missing the ExecuteMenu Function This is my code so…
Q: Question: From this comment---- Indicate how useful the feedback was. Did you understand the…
A: The given is a c++ program which reads the candidates and votes details from the input file and…
Q: C++ Help The program reads in variables totalVolume and itemVolume from input. An item takes up…
A: To input itemVolume and the volume of a box and find the remaining volume after filling as many…
Q: #include using namespace std; int main() { int no_quizzes, original_no_quizzes; float grade,…
A: As per the given question, we have to modify the code provided. Current Code performs the following…
Q: // Cornwall.cpp - This program computes hotel guest rates.// Input: None// Output: Hotel guest…
A: Actually, c++ is a powerful general purpose language. It is a high level language.
Q: C++ I have code: #include #include #include #include using namespace std; const std::string…
A: The below code is a C++ program that defines a function named "decodeMorse" that takes a string of…
Q: #include #include using namespace std; // declare functions void display_menu(); void…
A: Source Code : #include <iostream>#include <cmath>#include <cctype> // including…
Q: #include #include #include using namespace std; class BalancedTernary { protected: //…
A: Output of the given code: In the main function, the code asks for input of a,b,c and calls…
Q: Write a c++ program that prompts the user to enter a string, calls the function lowerUpperDigits( )…
A: #include <iostream>using namespace std;int lowerUpperDigits(string str, int* l, int* u){…
Q: // JumpinJava.cpp - This program looks up and prints the names and prices of coffee orders. //…
A: Coded using C++.
Q: his program converts characters to lowercase and uppercase
A: The problem statement is to convert an uppercase string to lowercase and store it in result1. And…
Q: C programming:you are to design and write a menu driven program as shown by the sample menu below.…
A: Given, C programming:you are to design and write a menu driven program as shown by the sample menu…
Q: 6330 ı you wir e tU WI e your aLateeLa. Instructions Lilal 1. Study the prewritten code to make…
A:
Q: // P41.cpp - A simple elevator for 4 floors and a basement with a // close door button and 5 keys…
A: #include<iostream> #include<cmath> using namespace std; void close_door(); int…
Q: C++ programming!!!! Abstract You are given a file containing many words. Read in all of the words…
A: Below is the program to achieve what is mentioned in the question. There are many function that are…
Q: Write a program that reads in a line consisting of a student’s name, Social Security number, user…
A: #include <iostream> #include<iostream> #include <string> using namespace std; int…
Q: Create two more functions (options #3 and #4 in your menu) by taking the to_celsius() and…
A: C++ program for the above two problems :
Q: In C++, using the functions rand and srand write a complete main function that simulates a lottery…
A: #include <iostream>using namespace std;int main() { // Using a seed value…
Q: C++ You are required to write a universal calculator that performs DOUBLE UP of different types of…
A: Add math. h,bits/stdc++.h in your header files section. #include <math.h> #include…
Q: #include#include#includeusing namespace std;// outputHtmlTitle// parameters// This function...void…
A: We need to print the html, head and title tag in the outputHtmlTitle() method.The outputHtmlTitle()…
Q: String with digit. Using C++ Set hasDigit to true if the 3-character passCode contains a digit.…
A: We will be using isDigit(c) function to check whether the string contains a digit or not. Code…
Q: o) implement the ReplaceExClanmationg fuiction. Replac haracter in the string with a character.…
A: string ShortenSpace(string sample_text){ int len = sample_text.length(); int i = 0; string…
Q: Flowchart, create. #include using namespace std; // Write function declaration here void…
A: This question comes from Programming Language flowchart designing which is a paper of Computer…
Q: C++ PLEASE!! // FILE: simplestring.h // CLASS PROVIDED: string (a sequence of characters)…
A: #include<iostream> #include<string> using namespace std; int main() { string…
Q: #include #include #include using namespace std; int main() { string userItem;…
A: Answer: #include <iostream>#include <sstream>//#include using namespace std; int main()…
C++
First, read in an input value for variable inCount. Then, read inCount integers from input and output each integer on a newline after the string "read-".
Ex: If the input is 2 45 55, the output is:
read-45Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- // Swap.cpp - This program determines the minimum and maximum of three values input by // the user and performs necessary swaps. // Input: Three int values. // Output: The numbers in numerical order. #include <iostream> using namespace std; int main() { // Declare variables int first = 0; // First number int second = 0; // Second number int third = 0; // Third number int temp; // Used to swap numbers const string SENTINEL = "done"; // Named constant for sentinel value string repeat; bool notDone = true; //loop control // Get user input cout << "Enter first number: "; cin >> first; cout << "Enter second number: "; cin >> second; cout << "Enter third number: "; cin >> third; while(notDone == true){ // Test to see if the first number is greater than the second number // Test to see if the second number is greater than the third number // Test to…Code is in C++ Instructions Write a program that reads in a line consisting of a student’s name, Social Security number, user ID, and password. The program outputs the string in which all the digits of the Social Security number and all the characters in the password are replaced by x. (The Social Security number is in the form 000-00-0000, and the user ID and the password do not contain any spaces.) Your program should not use the operator [] to access a string element. Input is as follows highlighted in bold John Doe 333224444 DoeJ 123Password My problem is with my output, i am close with the code, but i have attached what happens on my output and i cannot figure out why? You can see how it prints out multiple times but i am lost? The terminal image is also attached. Thank you! Here is the code: #include <iostream> //include statement(s)#include <iomanip>#include <string> using namespace std; //using namespace statement(s) void getInfo(string info); //void…please use DEQUE #include <iostream>#include <string>#include <deque> using namespace std; const int AIRPORT_COUNT = 12;string airports[AIRPORT_COUNT] = {"DAL","ABQ","DEN","MSY","HOU","SAT","CRP","MID","OKC","OMA","MDW","TUL"}; int main(){// define stack (or queue ) herestring origin;string dest;string citypair;cout << "Loading the CONTAINER ..." << endl;// LOAD THE STACK ( or queue) HERE// Create all the possible Airport combinations that could exist from the list provided.// i.e DALABQ, DALDEN, ...., ABQDAL, ABQDEN ...// DO NOT Load SameSame - DALDAL, ABQABQ, etc .. cout << "Getting data from the CONTAINER ..." << endl;// Retrieve data from the STACK/QUEUE here } Using the attached shell program (AirportCombos.cpp), create a list of strings to process and place on a STL DEQUE container. Using the provided 3 char airport codes, create a 6 character string that is the origin & destination city pair. Create all the possible…
- // SumAndProduct.cpp - This program computes sums and products // Input: Interactive// Output: Computed sum and product #include <iostream>#include <string>void sums(int);void products(int);using namespace std; int main() { int number; cout << "Enter a positive integer or 0 to quit: "; cin >> number; while(number != 0) { // Call sums function here // Call products function here cout << "Enter a positive integer or 0 to quit: "; cin >> number; } return 0;} // End of main function// Write sums function here// Write products function hereC++ Program: #include <iostream>#include <string> using namespace std; const int AIRPORT_COUNT = 12;string airports[AIRPORT_COUNT] = {"DAL","ABQ","DEN","MSY","HOU","SAT","CRP","MID","OKC","OMA","MDW","LAX"}; int main(){ // define stack (or queue ) here string origin; string dest; string citypair; cout << "Loading the CONTAINER ..." << endl; // LOAD THE STACK ( or queue) HERE // Create all the possible Airport combinations that could exist from the list provided. // i.e DALABQ, DALDEN, ...., ABQDAL, ABQDEN ... // DO NOT Load SameSame - DALDAL, ABQABQ, etc .. cout << "Getting data from the CONTAINER ..." << endl;// Retrieve data from the STACK/QUEUE here } Using the attached program (AirportCombos.cpp), create a list of strings to process and place on a STL STACK container. The provided code is meant to be generic. Using the provided 3 char airport codes, create a 6 character string that is the origin &…#include <iostream> #include <cmath> using namespace std; // declare functions void display_menu(); void convert_temp(); double to_celsius(double fahrenheit); double to_fahrenheit(double celsius); int main() { cout << "Convert Temperatures\n\n"; display_menu(); char again = 'y'; while (again == 'y') { convert_temp(); cout << "Convert another temperature? (y/n): "; cin >> again; cout << endl; } cout << "Bye!\n"; } // define functions void display_menu() { cout << "MENU\n" << "1. Fahrenheit to Celsius\n" << "2. Celsius to Fahrenheit\n\n"; } void convert_temp() { int option; cout << "Enter a menu option: "; cin >> option; double f = 0.0; double c = 0.0; switch (option) { case 1: cout << "Enter degrees Fahrenheit: "; cin >> f; c =…
- #include <iostream> using namespace std; int rectArea (int len, int wid) { return len * wid; } int main () { int length, width; cin >> length >> width; cout << "The area of a " << length << " by " << width << " rectangle is " << /*add code to call the reacArea function */ << "." << endl; return 0; }#include <iostream>#include <string>#include <fstream>#include <iomanip>#include <sstream> #include "card.h"#include "deck.h"#include "hand.h" using namespace N; using namespace std; /**main() controls the operation of the program*/ int main(){string repeat = "Y";Deck myDeck;Hand myHand;string exchangeCards; while (repeat == "Y" || repeat == "y"){cout << endl; myHand.newHand(myDeck);myHand.print();cout << endl; cout << "Would you like to exchange any cards? [Y / N]: ";getline(cin, exchangeCards); while (exchangeCards != "Y" && exchangeCards != "y" && exchangeCards != "X" && exchangeCards != "n"){cout << "Please enter Y or N only: ";getline(cin, exchangeCards); } if (exchangeCards = "Y" || exchangeCards = "y"){myHand.exchangeCards(myDeck);}cout << endl; myHand.print(); cout << endl; myDeck.reset(); // Resets the deck for a new game cout << "Play again? [Y / N]: ";getline(cin, repeat);while…#include#include#includeusing namespace std;// outputHtmlTitle// parameters// This function...void outputHtmlTitle(ofstream & fout, string title){fout << "" << endl;fout << "" << endl;fout << "" << endl;fout << "" << endl;fout << title << endl;fout << "" << endl;}void outputHtmlFooter(ofstream & fout){fout << "" << endl;fout << "" << endl;}void outputHtmlList(ostream & fout, string first, string second, string third){fout << "" << endl;fout << "\t" << first << "" << endl;fout << "\t" << second << "" << endl;fout << "\t" << third << "" << endl;fout << "\t" << endl;}void main(int argc, char * *argv){ofstream htmlFile("myIntro.html");string title;cout << "Please enter the title: ";getline(cin, title);outputHtmlTitle(htmlFile, title);string name;string course1, course2, course3;cout…
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.// LargeSmall.cpp - This program calculates the largest and smallest of three integer values. #include <iostream> using namespace std; int main() { // This is the work done in the housekeeping() function // Declare and initialize variables here int largest; // Largest of the three values int smallest; // Smallest of the three values // Prompt the user to enter 3 integer values // Write assignment, add conditional statements here as appropriate // This is the work done in the endOfJob() function // Output largest and smallest number. cout << "The largest value is " << largest << endl; cout << "The smallest value is " << smallest << endl; return 0; }