15. Filename: password dls369.cpp, but replace my email id with yours. (a) Write a function which returns true if a C-string contains a given character, false if the character is not present. Its exact declaration should be: bool contains_char(char cstring[], char target) The function should contain no cout statements. You may use strlen, but not strchr or std::string.find. Here are some test cases: • contains_char("", 'a’) H false • contains_char("a", 'a') H true • contains char("hello", 'h’) → true • contains_char("hello", 'e') → true • contains_char("hello", 'o') H true c("hello" !') H false

15. Filename: password dls369.cpp, but replace my email id with yours. (a) Write a function which returns true if a C-string contains a given character, false if the character is not present. Its exact declaration should be: bool contains_char(char cstring[], char target) The function should contain no cout statements. You may use strlen, but not strchr or std::string.find. Here are some test cases: • contains_char("", 'a’) H false • contains_char("a", 'a') H true • contains char("hello", 'h’) → true • contains_char("hello", 'e') → true • contains_char("hello", 'o') H true c("hello" !') H false

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter6: Modularity Using Functions

Section6.1: Function And Parameter Declarations

Problem 13E

See similar textbooks

Similar questions

C++ Programming. Theme: Standard string manipulation functions - string concatenation, comparison, character search, string search, replacement and deletion. Task : Write a program that replaces the second letter of every word in char string A with the third letter of every word in string B to get string S.
Code in c++ please
C++ - Vowels and Consonants
c code Screenshot and output is must
C++ programming
C programming In this task you are required implement a function that counts the number of alphabetical characters in a string. The function declaration is int count_isalpha(const char *str);. argument str is a constant string that will be processed to find the number of alphabetical characters. It returns the number alphabetical characters before the termination character
Programming language c++
C++ code NB: Pointers must be used
Complete the function empty which returns true if s1 has a length of 0. You may not use any library functions from . cstrings.cpp #include using namespace std; bool empty(const char* s) { 1 4 5 7 8 }
C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…
C++language
C++ code please Write a program that uses the function isPalindrome . Test your program on the following strings: madam, abba, 22, 67876, 444244, trymeuemyrt Modify the function isPalindrome so that when determining whether a string is a palindrome, cases are ignored, that is, uppercase and lowercase letters are considered the same. Your program should print a message indicating if a string is a palindrome: madam is a palindrome Use expressions: .+*isPalindrome\(\"Madam\"\).+* .+*isPalindrome\(\"abBa\"\).+* .+*isPalindrome\(\"22\"\).+* .+*isPalindrome\(\"67876\"\).+* .+*isPalindrome\(\"444244\"\).+* .+*isPalindrome\(\"trYmeuemyRT\"\).+* in the code.