Below is a picture of beta sheets connected by crossovers. Describe what is unique about this structure.
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…
A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…
Q: 1. Which of the following pathways of information flow has never been observed on Earth? chose all…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…
A: Lambda DNA is a linear DNA extracted from E coli bacteriophage with 485052 base pairs (bp) At each…
Q: The highest level of structural complexity completely retained by the molten globule state of a…
A: The term "molten globule state of a protein "refers to the diverse types of partially-folded protein…
Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…
A: The process of gene expression involves two steps: transcription and translation. Translation is the…
Q: In an uncatalyzed reaction, KF(uncatalyzed) = 2.5 X 10-8/s and Keq is 5 X 10². For the same reaction…
A: Consider the reversible reaction given below. A ⇄kRkF B Here , kF is the rate constant for the…
Q: Consider the structure of the tripeptide (in its fully protonated form) below. H O H I | || + O=C…
A: The amino acids contain ionizable groups. The ionizable groups are of the following types: the amino…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: 3. Subtilisin (Mol. weight 27,600) is a protease that can catalyze hydrolysis of certain amino acid…
A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…
Q: determine if stirring (Pé > 1) is more efficient than diffusion (Pé < solutions. “Stirring" here can…
A: U
Q: 5. In the early days of protein biochemistry, these proteins were described using "operational…
A: Operational definition is applicable to many things in our everyday life. It is most popularly used…
Q: ENERGY vum Intermediate folding states Folded protein ww CONFIGURATION Figure 1: The Thermodynamics…
A: The proteins are constituted of twenty naturally occurring amino acids that are connected via…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Phospholipids are compound lipids composed of fatty acid, alcohol, nitrogen containing molecules,…
Q: 5. Let's revisit the question from last week's problem set with the cellulase enzyme discovered by…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: Explain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity…
A: The pyruvate dehydrogenase complex is composed of three subunits named pyruvate dehydrogenase,…
Q: A mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100…
A: Mass spectrometry is an analytical method that involves ionizing materials into charged molecules so…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: Discuss the principles of Thiobarbituric reactive species (BARS) assay
A: Within a cell, reactive oxygen species (ROS) such as singlet oxygen, peroxides etc are produced as a…
Q: Carbohydrates that appear in glycosylated proteins and lipids in the GA include I.…
A: Golgi do post-translational modifications in protein. Such as attaching carbohydrates with…
Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…
Q: *The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Suppose you have three polysaccharide samples, one of amylose, one of amylopectin, and one of…
A: Polysaccharides are the complex carbohydrates that are made up of monosaccharides joined by…
Q: Which technique would best seperate a protein that binds stongly to its substrate?
A: Chromatography is a technique that is used for separation of biological macromolecules form a…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Determine the fraction of Vmax that would be obtained when the substrate concentration, [S], is 0.5…
A: Enzymes are biological catalysts that increase the rate of biological reactions. Most enzymes are…
Q: What is the net production/usage of ATP and redox cofactors if a glycerol (triaceylglyceride…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: Activities found in the rough ER and its functions include the folllowing EXCEPT provides a…
A: Rough Endoplasmic reticulum is the important cell organelle that is essential for synthesis of…
Q: Define vmax. How is vmax related to kcat?
A: The rate of a reaction can be monitored by various parameters. These are Km, Vmax, Kcat etc. Each of…
Q: How can RNA sequencing (RNA-Seq) and microarrays in Transcriptome analysis find disease genes?
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: 50. Express each of the following as a per- centage strength: (a) 1:1500 (b) 1:10,000 (c) 1:250 50.…
A: The Percent solutions can be in the form of weight/volume percentage, volume/volume percentage.…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: Inhibitors inhibits the enzyme activity. There are three types of inhibitors-Competitive,…
Q: How to calculate percentages of arginine 's side chain have positively charge at PH=7
A: INTRODUCTION: Arginine : It is an amino acid with the chemical formula CN(CH2)3CHCO2H. Its molecule…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: A 100 mL of 0.1 M amino acid at pH 1.0, whose pKa for the carboxyl group is less than the pKa of the…
A: The amino acids carry different ionizable groups. The ionic form of the amino acids depends upon the…
Q: In the final step of the citric acid cycle, malate is oxidized to regenerate the oxaloacetate…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: 3. 1,3-bisphosphglycerate has a high energy bond that can be used to phosphorylate ADP to make ATP…
A: Delta G or the standard free energy of a reaction indicates the tendency of a reaction to move…
Q: Which of the following amino acids is generally absent from an a-helix? tryptophan serine isoleucine…
A: The alpha helix is secondary structure of protein in which the amino acid chain is arranged in a…
Q: [Select] 1. Using hydrophobic interaction chromatography, the protein that will be eluted last is 2.…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following interactions would be involved in quaternary structure? hydrogen bonds O…
A: Proteins composed of more than 1 polypeptide chain has Quaternary structure. Each polypeptide chain…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Sodium Do-decylSulphate PolyAcrylamide Gel Electrophoresis (SDS PAGE) is a method used to separate…
Q: The TPOX locus is one of the genetic loci used for forensic analysis of DNA. The TPOX locus has the…
A: Forensics DNA profiling can be used to solve old or unsolved crimes and to identify the person…
Q: Arrange the events of replication chronologically from A (first) to G (last event): -Sealing of…
A: Replication is the process in which duplication of DNA takes place inside the nucleus. this process…
Q: For the mutation of the enzyme below, describe the effect it will have on carbohydrate metabolism.…
A: Fructose 2,6-bisphosphate is an allosteric activator of the enzyme Phosphofructokinase-1 (PFK-1) ,…
Q: 4. You are to choose the members of an expedition that will climb several high mountains. Each…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: If the hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase has a ΔG′∘ of…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: At a substrate concentration that is much greater than the KM for the reaction, which statement is…
A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V= velocity of the…
MN.5.
Step by step
Solved in 2 steps with 1 images
- In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?Draw a two-stranded anti-parallel beta-sheet where each strand is 5 amino acids long. Use “R” to show the placement of the side chains and indicate H bonds. Also, use wedges and dashes to indicate directionality of R and H.The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. Possible location of a terminator
- What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in Single Cell Protein.Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.What is an SMC complex? Describe two examples