Q: Which statement is FALSE The kidney produces a concentrated urine by establishing a high…
A: The human body has different organ systems that perform different functions such as nutrition,…
Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…
A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…
Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…
A: Im answering only first part Answer :- We know that genotype contributes to phenotype. Genotype is…
Q: A student was observing a filament of blue green bacteria under low power (60X). The diameter of the…
A: A. Average length of one cell = 2.4 mm/ 40=0.06 mm Under 60X = 40 cells, each is 0.06 mm in length
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: 51- are links between the Filamentous F-actin of thin filaments and myosin heads of thick filaments.…
A: Introduction Muscle contraction is the activation of tension-generating sites within muscle cells,…
Q: Mr Ojomu is a 42 year male of African origin. He has a demanding desk-based job and frequently has…
A: Mr Ojomu is a 42 year male of African origin. He has a demanding desk-based job and frequently has…
Q: In humans the wall of the left ventricle is thicker than that of the right ventricle. This…
A: Cardiovascular system The circulatory system is also referred to as the cardiovascular system. It is…
Q: Below are aberrations due to changes in chromosomal structure and number. Identify of the following…
A: Down’s syndrome- trisomy of 21st chromosomes. Cri-du-chat (cat's cry) syndrome, also known as 5p-…
Q: The diagram on the right has been drawn to scale. The width of the cell has been drawn at 5 cm. What…
A: Width = 5 cm Scale 1 cm = 10 um So 5 cm= 50 um So the magnification is size of image/ actual…
Q: Insulin-like growth factor 2 (IGF2) is located on chromosome 11. My maternal copy of chromosome 11…
A: The IGF2 gene provides instructions for making a protein called insulin-like growth factor 2. It…
Q: What proportion of your diet would you estimate consists of meat, milk, eggs, or other animal…
A: Introduction The biochemical and physiological process by which an organism uses food to sustain its…
Q: Give the chromosome number for the following: 1. 2n=4 treated with colchicine to produce an…
A: Every organisms have different chromosomes number. In human chromosome number is 46 , it is varies…
Q: DRAW A LOCAL FOOD WEB AND IDENTIFY THEIR NAMES
A: A local food web depicts the connections between food producers, retailers and consumers. The…
Q: Energy and cellular functions: The evolution of the Prokaryotic cell type into the Eukaryotic cell…
A: Chloroplasts are structure exclusive to the eukaryotic organisms. This was an important development…
Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…
A: Since you have asked the multipart question, we will solve the first three questions for you. If you…
Q: Sample A: Sample B: Sample C: Sample D: Sample E: Sample F: 22mm 18mm 35mm 30mm 28mm 28mm 21mm 17mm…
A: Introduction The zone of inhibition is the area around an antibiotic pot where bacteria cannot grow.…
Q: The structure of DNA requires both hydrogen bonds and phosphodiester bonds. Describe the location…
A: Introduction Because of bond-polarity-derived attraction forces, two molecules having polar bond…
Q: 2 -3 Which cranial nerve innervates the eye muscle labeled 2 in this diagram?
A: Introduction: Six cranial nerves innervate in eyes.motor, autonomic and sensory. The muscles…
Q: are considered as two antagonistic hormones in the control of calc and 27- homeostasis A Calcitonin…
A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…
Q: How Alamanda Cathartica helps to prevent the lice on hair?
A: Alamanda Cathartica It is also called golden trumpet. It is a flowering plant which produce…
Q: You were asked to invent substitutes for blood vessels (artery, capillary, and vein). What materials…
A: To produce the vascular prostheses, polymer solutions were spun in an electrical field to form very…
Q: To determine: The way by which scientist can tell that a protein present in bacteria and fruit fly…
A: Proteins are usually defined that they are about to refer as they are necessary for the human body…
Q: Twenty-three milligrams of glucose were eaten by the bacteria Sanacoccus puma- amount of ATP your…
A: According to questions... 180g of glucose equal to 1 mole. 23mg glucose produced.... 1 mg= 10-3gm.…
Q: To determine: The reason due to which some RNA molecules can act as enzymes or biological catalysts,…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: Ten glyceraldehyde-3-phosphate (G3P) produced by the Calvin cycle is used to produce a. 5 glucose.…
A: Photosynthesis is a metabolic process in which organic material ( glucose ) is synthesized from…
Q: Using ALL of these terms: antigen antibodies plasma erythrocvte please describe WHY a person with B-…
A: B blood group has antigen B(agglutinin) and antibody anti-a ( agglutinogen) . AB blood group has…
Q: Briefly describe a generalized plant embryogenesis.
A: Plants are eukaryotic, multicellular organisms belonging to the kingdom Plantae and are capable of…
Q: chromosomes
A:
Q: 1. Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates…
A: Insects are members of the phylum Arthropoda, which is the largest in the animal kingdom and…
Q: Please answer asap You are caring for a patient with pulmonary (lung) Mycobacterium tuberculosis The…
A: Pathological presentation of infection caused by bacteria Mycobacterium tuberculosis .
Q: Identify the function of the Purkinje fibres. Select one: O a. O b. O c. O d. act as a pacemaker and…
A: The conducting system of heart consists of SA node, AV node, Right and left AV bundles, purkinje…
Q: Based on the characteristics presented, entoprocts are closely related to which lophophorate phylum?…
A: Aquatic animals, whether invertebrates or vertebrates, are animals that live in water for most or…
Q: 9-year-old girl presents to your pharmacy. Her mother tells you that the child has been generally…
A: The various causes that may leads to breathlessness in the child are: Asthma Pneumonia Congestive…
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: (c) Write short notes on what type of preparation is needed for a specimen in order to allow it to…
A: Samples must be small enough to fit in sample chamber Samples must be electrically conductive and…
Q: 1. What is the significance of detecting cells in CSF count. What are the normal and abnormal…
A: CSF, cerebrospinal fluid is presnt inside the ventricles of brain and in subarachnoid spaces of…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: To determine: The reason due to which scientists think that new genes arise by the duplication of an…
A: The basic structure and functional unit of heredity is the gene. Diversity allows genes to evolve…
Q: Your body releases Anti Diuretic Hormone (ADH) from the pituitary gland when O When you're hungry…
A: Introduction Hormones are chemical substances that function in the body as messenger molecules. They…
Q: Which of the following would be considered a primary role of the large intestine? O Increase the…
A: Large intestine has 3 primary functions : Absorbing water and electrolytes Producing and…
Q: The global human population has surpassed 7 billion, far exceeding our population’s size throughout…
A: Introduction The carrying capacity of an environment refers to the maximum population number of a…
Q: Suggest key roles that mineralized bone might have played in early vertebrates.
A: Introduction :- A bone component called hydroxyapatite makes up nearly 70% of bone. The tissue is…
Q: 1) Living things are made mostly from just 4 elements. Based on the number of bonds each of them is…
A: Main 4 elements are hydrogen , oxygen , carbon and nitrogen. These are most commom elememts in…
Q: . Differentiation of the Spemann’s primary organizer requires which of the following?* a.…
A: Spemann’s primary organizer are the transplanted tissue of early gastrulas and its dorsal lip used…
Q: The structure of the C4 leaf shows how mesophyll cells hug the epidermis of the leaf. hug the bundle…
A: Photorespiration is a wasteful pathway that occurs when the Calvin cycle enzyme rubisco acts on…
Q: Which heart do you think is most efficient at delivering oxygen rich blood to the tissues? O 3…
A:
Q: To determine: The ways by which the exon/intron structure of genes contributes to the generation of…
A: Thus, a gene is a fundamental unit of heredity that carries coded information associated with a…
describe the sequence of events in the migration of leukocytes to sites of infection
Step by step
Solved in 2 steps
- Describe the mechanisms by which leukocytes migrate from thebloodstream into an area of infection. What chemical factors are theyreacting to?Explain the sequence of stages involved in leukocyte recruitment into tissues during inflammation : Rolling, activation and extravasation]Explain the sequence of stages involved in leukocyte recruitment into tissues during inflammation : Rolling, activation and extravasation. Explain the role of adhesion molecules such as selectins and integrins during the stages.
- If a person is given a transfusion with the wrong blood type, what mechanism of action is responsible for the reaction seen in the body? O 1) IgE binds to mast cells releasing cytokines 2) Antigen-antibody complexes (IgG, IgM and IgA) lodge in basement membranes of tissues, neutrophil degranulation damages the tissues O 3) T cells respond to the inappropriate cells 4) IgG and IgM bind to cells stimulating complement, triggering cell lysisAttraction of leukocytes to an inflammatory site is called b) chemotaxis X) margination e) phagocytosisWhich leukocytes type would likely be elevated in a patient who has tapeworm? Explain?
- Define the term major histocompatibility complex. Identify the three-classes of MHC .Diagram the process of phagocytosis, separately for neutrophils and macrophages. Briefly describe all steps of the process.List and briefly describe the six basic types of leukocytes and their derivate cells. Basophils/Mast cells: Eosinophil: Neutrophil: Macrophage/Monocyte: Dendritic Cells: Lymphocyte: