B 120° A. B Give the name for the three-dimensional VSEPR structure.

Q: H PhH₂CH₂C PhH₂CH₂C H 14 .... CH3 4 CH3 mcpba mcpba ? ? HT/H₂O H™/H₂O ? ?

A: Organic reactions are those in which organic reactant react to form organic products.

Q: 7. The following compound is a(n) HyÑ-ÇHC-N-CHC-H-CHể-o || H3N-CHC-N-CHC-N-CHO-O СНCHЗ CHз ČH3 CH2…

A: Amino acids are the carboxylic acids having an amino group. Peptides are short chain  of amino acids…

Q: Question 16.a c Proteins fold into complex three-dimensional upon the structure of the protein and…

A: Proteins are made up of amino acids. Protein fold in to three dimensional shape. Globular proteins…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: Consider a protein with five amino acids and three possible energy levels (separated by 1 J/mol)…

A: Step 1:    this statistical mechanics problem.The question asks you to consider a protein with five…

Q: 12) Proteins are long chains of amino acids joined together by peptide bonds. Which structure…

A: Given, The structure properly depicts the peptide bond formed between two generic amino acids is:

Q: The amino acid glycine has the molecular formula C,HgNO,, and the amino acid isoleucine has the…

A:

Q: C12H22011 is an example of a a) monosaccharide b) disaccharide c) polysaccharide d) starch

A: A monosaccharide is a sugar that is no longer able to break down into simpler sugars. It is the…

Q: The below molecule of mannose is the [Select ] anomer. A glucose molecules used to my cellulose…

A: Beta glucose( group on 1 ,6 position are on same side) see in below attached figure. is the monomer…

Q: Q3: Use arrows to match the terms (A) column with (B) column. Some may be used more than once and…

A: Biomolecules such as proteins, cholesterol, lactose, waxes, Angiotensin II are produced by cells and…

Q: CI ОН HNO3-H₂SO4 ??

A:

Q: c

A: Given information, 3 amino acids joined together by two peptide bonds. An amino acid that can form…

Q: Consider the formation of a dimeric protein 2P  ->P2   At 25.0 °C , the enthalpy of the reaction…

A:

Q: Draw the major products of this reaction. Ignore inorganic byproducts.

A: One of the important reactions of alkene is ozonolysis. In the ozonolysis reaction, the…

Q: In addition to their use in water treatment, ion-exchange resins are used to extract Au, Ag, and Pt…

A: Small repetitive units of a compound called monomers are connected chemically to form a long chain…

Q: I NaN3

A:

Q: Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different…

A: DNA and RNA are nucleic acids, that are important for the storage of genetic information and…

Q: Draw the structure of serylarginine, a dipeptide made from serine and arginine, as it would appear…

A: We have to determine the structure of serylarginine at physiological pH.

Q: An optically inactive triglyceride V (M and two moles of myristoleic acid (14:1 i. Draw the…

A:

Q: OH fatty acid ☐ monoglyceride ☐diglyceride ☐triglyceride saturated unsaturated monounsaturated ☐…

A: Fatty acid: Fatty acid is the carboxylic acid of aliphatic chain of hydrocarbon.monoglyceride:…

Q: hbgthh

A: Can you post a right question

Types of Polymers on the basis of Method of Preparation