An analysis is performed to determine the proportions of each of the four nucleotide bases in the DNA of several tissue samplesfrom various species. The results appear in the table.HumanChickenYeastE. coli% Adenine % Guanine(A)(G)3120282132182625% Thymine % Cytosine(T)30293324Which conclusions can be drawn from this data?(C)19221725The proportion of G is roughly equal to the proportion of C.The proportion of A is roughly equal to the proportion of T.The proportion of pyrimidines is roughly equal to the proportion of purines.The proportion of A-T base pairs is roughly equal to the proportion of G-C base pairs.

The genetic material in the cells of most organisms is DNA or deoxyribonucleic acid. DNA is…

Answered: An analysis is performed to determine…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

please solve this with step-by-step calculations and explanations.
The GC content of the DNA in the genome of a newly discovered bacterium is 46%, what is the percentage of Thymine in the genome this organism?
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Analogs of nucleotides are often used in studies of DNA. An analog is a modification of one of the normal bases that can be incorporated into DNA via replication and can later be detected for analysis. The thymidine analog 5-ethynyl-2′-deoxyuridine (EdU) is widely used in the laboratory for these types of experiments. However, EdU is toxic to cells, and inclusion of EdU in growth medium eventually causes cell death, unlike other thymidine analogs. Recently, a research team examined if cells recognized EdU as damage to the DNA and if the cells used the nucleotide excision repair (NER) systems to fix the DNA (see figure A). Human cells cultured in the lab were treated for 24 hours with either EdU or another thymidine analog, BrdU (blue circles in the figure). The cells were then exposed to UV light where damage would occur (red triangles in the figure). After 1 h of repair in the presence of the analog, the cells were lysed and excision products were separated from cells. An…
One of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic material is compacted by wrapping the double-helix around histone proteins to form nucleosomes. 2. Eukaryotic genetic material consists of supercoiled circular DNA molecules complexed with proteins into chromosomes. 3. Eukaryotic genetic material consists of relaxed linear DNA molecules complexed with RNA into a 30 nm fiber. 4. Eukaryotic genetic material is compacted by folding linker regions around non-histone proteins to form a scaffold.
In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their genetic information into their host cells, scientists were able to track the movement of phosphorus and nitrogen from the virus to its host cell. Which of the following describes the most likely conclusion from this observation? A B с D The molecule that is transmitted by the virus is a protein since proteins contain nitrogen but nucleic acids do not. The molecule that is transmitted by the virus is a protein since proteins contain phos- phorus but nucleic acids do not. The molecule that is transmitted by the virus is a nucleic acid since nucleic acids contain phosphorus but proteins do not. The molecule that is transmitted by the virus is a nucleic acid since nucleic acids contain nitrogen but proteins do not.
You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm
By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please
Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?
The question is attached
För each of the biological samples determine the amount of nucleotide units for each DNA sample. TYPE in the answers into the blank cells of the table, you will have to use the scroll bar to see the entire data table. The answers to the blank cells can be calculate using the equation in the Hint. A %3D ..is always equal to T+ C. In DNA, A + G... Purines = Pyrimidines 2. Hint:[A]+[T]+[C]+[G]=100% • Saved Hint: #A= #T #G= #C Source of DNA Adenine Guanine Cytosine ... Thymine 1 Sea Urchin 32 18 18 32 Salmon 29 42 42 29 3 E. Coli 36 14 14 4 Human 41 9.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS