Alterations of chromosome structure can not be resulted from: اختر احدى الاجابات Translocation Deletion Crossing over Duplication Inversion

Q: Chromosome breakage followed by DNA repair, orillegitimate crossing-over in which _____________…

A: Chromosomal rearrangement encircles many different classes of events such as duplications,…

Q: Karyotype analysis shows that the banding pattern for chromosome 1 is the reverse of the normal…

A: Introduction : A Chromosome Is A Lengthy DNA Molecule That Contains Part Or All Of An Organism's…

Q: Exchange of genetic information between two non-homologous chromosomes is called? Inversion…

A: Introduction Chromosome:- A structure found inside the nucleus of a cell, It is an organized package…

Q: An inversion heterozygote has the following inversion chromosome:     What would be the products if…

A: Chromosomal inversion is a type of mutation where the segment of chromosomes undergoes breakage and…

Q: * 10 11 12 13 14 15 14 17 18 %3D 19 20 21 22 Chromosome counts: Кагyotype: Interpretation:

A: Karyotyping is developed by S.Navashin, based on the observation of chromosomes number and…

Q: Arugue the pros and cons having a nucleoid.

A: Nucleus is an organelle present in a cell that houses the genetic material, DNA or RNA. It is the…

Q: where is the chromosome abnormality? (chromosomes 1-23)

A: The chromosomal abnormality is the result of errors in the cell division following meiosis or…

Q: Identify the chromosome rearrangement that occurred between the two homologous chromosomes shown on…

A: Mutation:   Mutation refers to any change or alteration that occurs in the genetic material (DNA) of…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Human cell contains 23 pairs of chromosomes.  22 autosomes and 1 pair of sex chromosomes. Human male…

Q: me organismyou are working with has the following chromosomes. Place the chromosomes of this…

A: The mitosis is the cell division process by which a diploid (2n) mother cell divide and produce two…

Q: Consider the following genetic map from Mischievous gremlinus: A 6.0 CM H B + 13.4 CM C Interference…

A: Three genes control three traits in the mischievous gremlinus. Alleles A, B, and C represent the…

Q: What causes monosomy and trisomy disorders? deletion insertion translocation O non-disjunction

A: Monosomy and trisomy-  Monosomy = It is the type of aneuploidy when only one chromosome of a pair is…

Q: complete the venn diagram.

A: Genetics is crucial since it is what distinguishes you. Genetics studies inheritance or the…

Q: Explain why indirect flight muscles can beat much more rapidly than direct flight muscles.

A: The Flying in insects is brought about and controlled by the flight muscles. Two of these flight…

Q: Define chromosome painting.

A: A chromosome is a long DNA molecule with some part of all genetic material. Most of the chromosome…

Q: Explain the difference between crossing over and reciprocal translocation. Give an example of a…

A: Genetic recombination is a process by which organisms acquire genetic diversity. The exchange of…

Q: Gene duplications are commonly observed in genomes of higher eukaryotes including humans. Which of…

A: The sequence of DNA or specific nucleotide sequence which is repeated multiple times within a genome…

Q: With the given frequency, construct a chromosome map. Arrange the sequence correctly. Write the…

A: Step 1 A linkage or chromosome map is a linear graphic representation of the sequence of genes…

Q: Describe a chromosomal deletion, duplication, translocation, and inversion.

A: Chromosomes are string-like designs situated inside the nucleus of animals and plant cells. Every…

Q: Duplication Inversion Deletion

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: Explain the reason why a dicentric chromosome is unstable.

A: Chromosomes having two centromeres are said to be dicentric. The centromeres on chromosomes…

Q: %3D 10 11 12 म 11 16 17 D

A: Answer. The number, sizes, and shapes of the metaphase chromosomes constitute the karyotype or…

Q: If you are provided with a family having agenetic disorder in the members.using single strand…

A: Answer: PEDIGREE ANALYSIS : The study of family genetic tree is called pedigree analysis. It is a…

Q: 14 Duplication Inversion Deletion

A: BASIC INFORMATION  MUTATION  it is sudden or discontinuous variation these changes occurs in the…

Q: A patient has abnormal expression of two genes at distant locations on the same chromosome. The…

A: Change in the DNA sequence or the number or structure of chromosomes is known as mutation. Mutations…

Q: For each of the terms in the left column, choose thebest matching phrase in the right column.a.…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Why do deviations from the normal chromosome number of 46affect health?

A: Karyotype is a diagrammatic representation of arrangement of chromosomes. Humans have 46…

Q: the deletion of which chromosome causes obvious morphological and mental defects in the organism,…

A: Cri-du-chat syndrome, otherwise called 5p-(5p minus) syndrome or cat cry syndrome, is a chromosomal…

Q: Explain how chromosome deletions, inversions, and translocations can cause cance

A: any change in the number or structure of the chromosome is termed as chromosome aberration, it is of…

Q: Which of the following is described as a structural rearrangement of a chromosome in which a broken…

A: Chromosomal rearrangements consist of different events- deletion, duplication, inversion, and…

Q: Chromosomal Abnormalities Name of Abnormality Number of Classification Affected Description…

A: Chromosome abnormalities are caused by the mutations due to an error in cell division which either…

Q: Ir il 9 10 11 12 x* 13 14 15 16 17 18 20 22 Chromosome counts: Karyotype: Interpretation:

A: In human the total chromosome number is 46. Between these 46 chromosomes, 44 chromosomes are…

Q: In which parent and during which meiotic division did non-disjunction occur? If there is more than…

A:

Q: Human chromosome 11 GC content is 42%. What is the percentage of each nucleotide on chromosome 11?

A: According to Chargaff rule,- in DNA there is always equality in quantity between the bases A and T…

Q: Different versions of the same gene are called: Chromosomes O Alleles DNA O Daughter Cells

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Explain why these homologous chromosomes can synapse only if an inversion loop forms?

A: Synapsis is a process which is defined as the pairing of two homologous chromosomes during meiosis…

Q: Put the following events concerning homologous recombination (the mechanism by which crossing over…

A: Genetic information is shared between two identical or comparable double-stranded or single-stranded…

Q: 14 13 1a 131 is a diagram of chromosome 17.

A: A chromosome is a long DNA molecule that contains part or all of an organism's genetic material.…

Q: Group of answer choices Statement 1 is correct. Statement 2 is incorrect

A: Neurofibromatosis (NF) is a neurodegenerative disease that affects the brain, spinal cord, nerves,…

Q: What is the notation for the following cases? ( A female having Edwards syndrome (trisomy 18)

A: The chromosomal syndrome notation includes the total number of chromosomes, then the sex chromosome,…

Q: A chromosome with the following gene order has a paracentric inversion of BCDE. A B C D E F • G H If…

A:

Q: A young couple is planning to have children. Knowing that there have been a substantial number of…

A: Robertsonian translocation is a kind of chromosomal abnormality in which two acrocentric chromosomes…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Changes in Chromosome Structure and Number An inversion heterozygote has homologous chromosomes with…

A: The question pertains to the study of changes in chromosome structure and number, specifically…

Q: Heliodors are either red (R), yellow (Y) or an intermediate phenotype, orange.   What is the…

A: The phenotype of an individual is determined by their genotype and expressed genes, as well as…

Q: Why would a cell in metaphase be more useful than acell in interphase for producing a karyotype?

A: Karyotypes are generally made from mitotic cells which have been arrested in the metaphase or…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.