**Question:**All of the following statements about glucose are true *except*:- Glucose is metabolized in the cytoplasm of prokaryotic organisms.- On a low-carb diet, keto acids from glucogenic amino acids will be used to synthesize glucose.- Glucose is metabolized in the mitochondria of mature red blood cells.- Under non-starvation conditions, the brain relies exclusively on glucose as its fuel source.**Explanation:**The question presents four statements related to glucose metabolism, asking which one is incorrect. It highlights key concepts about glucose utilization in different biological contexts, including cellular metabolism, dietary impact on glucose synthesis, and energy sources for the brain. Note that mature red blood cells lack mitochondria, affecting how and where glucose is metabolized within these cells.

All of the following statements about glucose are true except: Glucose is metabolized in the cytoplasm of prokaryotic organisms. On a low-carb diet, keto acids from glucogenic amino acids will be used to synthesize glucose. Glucose is metabolized in the mitochondria of mature red blood cells. Under non-starvation conditions, the brain relies exclusively on glucose as its fuel source.

All of the following statements about glucose are true except: Glucose is metabolized in the cytoplasm of prokaryotic organisms. On a low-carb diet, keto acids from glucogenic amino acids will be used to synthesize glucose. Glucose is metabolized in the mitochondria of mature red blood cells. Under non-starvation conditions, the brain relies exclusively on glucose as its fuel source.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which of the following statements is falseconcerning acetyl CoA carboxylase (ACC)? ACC is more active when protomers condense to form polymers Palmitoyl CoA serves as a feedback inhibitor The source of carbons for ACC comes from the carbon skeletons of malate that is exported from the matrix of the mitochondria in the form of malate Binding of glucagon triggers cAMP production, which leads to inhibition of ACC
Which of the following statements is TRUE about fatty acid biosynthesis? Group of answer choices: NADH is used as the reducing equivalent in the process. Malonyl ACP is the donor of the acetyl group. The product detaches from the fatty acid synthase complex when the chain length is usually 18 carbons. Oxaloacetate carries acetyl CoA to the cytosol.
Isozymes: d) One way of regulating metabolic pathways is through isozymes. What is an isozyme? e) Provide a concrete example of an isozyme from carbohydrate metabolism. f) From your chosen isozyme in part b), describe how it is regulated differently in various cells.
The body uses carbohydrates, fats, and proteins to fuel all its activities. These fuels each start down a different path, but they all ultimately end up providing energy by going through the TCA cycle and electron transport chain. Identify which compounds can be formed during metabolism from each fuel source. Compounds Formed During Metabolism Glucose Fuel Sources Glycerol Fatty acids Glucose Glucogenic amino acids Ketogenic amino acids Acetyl COA Pyruvate Lactate O B U 0 040 O O D 0 0000 1 200000 Fat
What is the key regulatory enzyme in glycolysis? Please explain how this enzyme is regulated just after a meal has been consumed.
Gluconeogenesis requires how many NTPs (nucleotide triphosphates, i.e. ATP, GTP)? Group of answer choices 4 0 2 1 6 Which of the following is true about gluconeogenesis? Group of answer choices It can be used by the liver to produce glucose when blood glucose levels are low It produces 4 ATP It produces lactate It converts 1 glucose into 2 pyruvate Where does conversion of glucose 6-phosphate to glucose take place? Group of answer choices Cytoplasm Endoplasmic reticulum Mitochondria Nucleus
which of the following is not true for a muscle that is forced to metabolize glucose anaerobically ? - The cells breakdown glucose faster - The cells produce less ATP per mole of glucose - The cells metabolize glucose to lactate - The activity of the cytosolic gycerol-3-phosphate dehydrogenase will be required for the muscle to sustain glycolysis - The muscle quickly experiences fatigue if it is deficient in the enzyme lactate dehydrogenase
The brain can also use ketone bodies as fuel in addition to utilising glucose when it is present.Even the use of ketone bodies as a fuel source for the brain rather than glucose is supported by data.How are ketone bodies used by the brain? Discuss how brain metabolism is thought to be changed inneurodegenerative diseases(refer to the figure below) How does the brain benefit from using ketone bodies as fuel in these cases(refer to Figure below)Refer to the article " Effects of Ketone Bodies on Brain Metabolism and Function in Neurodegenerative Diseases" to answer the questions. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7699472/
Which of the following is true for eukaryotic cells? Choose one: O Fats are converted to acetyl CoA in the mitochondria; sugars are converted to acetyl CoA in the cytosol. O Sugars are converted to acetyl CoA, but fats are not. Fats are converted to acetyl CoA, but sugars are not. Sugars and fats are both converted to acetyl COA in the mitochondria. O Sugars are converted to acetyl CoA in the mitochondria; fats are converted to acetyl CoA in the cytosol.
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?
Describe the breakdown of sucrose in the body and the revelant pathways of the byproducts. In the breakdown, be sure to use the following terms: active site, disaccharide, enzyme-substrate complex, fructose, glucose, glycosidic bond, hydrolysis, product, substrate, sucrase (the enzyme that splits sucrose), and sucrose. Also explain what happens to glucose and fructose in the liver.
The compound glucose 6-phosphate is NOT encountered in which of the following processes? conversion of pyruvate to glucose conversion to glucose to pyruvate conversion of glycogen to glucose conversion pyruvate to citrate conversion of glucose to fructose 1,6-bisphosphate