AKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production O MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication O Nucleotides in each original strand serve as a template for the new strand to be made
Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…
A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…
Q: Match Column A (Description) with Column B (protein/enzyme)
A: One new strand (the leading strand) is created as a continuous segment during DNA replication. The…
Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…
A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…
Q: During DNA replication, both positive and negative supercoiling is introduced in the DNA being…
A: Loosening up of the helix during Deoxyribose Nucleic Acid (DNA) replication (by the activity of…
Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…
A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…
Q: representation of DNA replication. Complete your representation for a single helical turn. 2.…
A: Gene expression is a complex process in which a required protein is synthesized by the instructions…
Q: Which of the following statements is true about DNA? Select one: O a. DNA transmit the genetic…
A: The DNA is one of the type of nucleic acids and is made from nucleotides that contains five carbon…
Q: AKS 5b: Using the semi-conservative model of DNA replication, how many of the resulting DNA…
A: Semi conservative replication The replication of DNA is semi conservative in nature because the…
Q: 1. For cach of the items below, give a brief description (indicate function for enzymes) and…
A: All the above-mentioned enzymes are part of the central dogma of the cell. It consists of three…
Q: 1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: replication fork and the synthesis of the new strand can continue without interruption as the…
A: Replication is the process in which DNA duplicates itself. Replication occurs when the replication…
Q: DNA replication reaults in two daughter double hellces, each containing one atrand from the original…
A: DNA replication The production of new double stranded DNA from old one is known as DNA replication.…
Q: From among only the following, the THIRD step in DNA replication is Primase produces an RNA primer…
A: Primase creates an RNA primer, which is a brief stretch of complementary nucleic acid that serves as…
Q: How does DNA replicate itself? Describe leading and lagging strand replication. What isthe role of…
A: The process of formation of two DNA molecules from one parent molecule is called DNA replication. In…
Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…
A: DNA replication is the process of production of identical copies of DNA molecules with the help of…
Q: AKS 5c: Which student correctly explained what is occurring in the images? * 3" ECCUAL FAC 3 Met Leu…
A: The deoxyribonucleic acid (DNA) is the genetic material of all organisms, which involves the…
Q: Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose]…
A: DNA replication is a process by which a new strand of DNA is synthesized using the existing DNA…
Q: Explain how the molecular mechanism of DNA polymerase enhances DNA replication.
A: Introduction - The replication of a double-stranded DNA molecule produces two identical DNA…
Q: Which of these molecules links the most of the individual DNA nucleotides together on the newly…
A: ENZYME:- It is defined as a complex biological catalyst i.e produced by a living organisms in its…
Q: AKS 5c: In eukaryotic organisms like humans, DNA never leaves the nucleus. Which of the following is…
A: DNA contains all the information necessary for the regulation of cell metabolism in its nucleotides…
Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…
A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…
Q: In relation to central dogma of molecular biology answer the following questions: A- Give two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…
Q: Determine what amino acid will be formed from the given DNA strand below:…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…
A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…
Q: I need question 25
A: Telomeres are compound structures that are present at the end of chromosomes and play an essential…
Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…
A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'
Q: What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand…
A: DNA replication is a process by which one parent DNA replicates to form two identical daughter DNA.…
Q: "DNA is passed from one generation to another during cells division after DNA replication". which of…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the…
A: DNA(Deoxy ribonucleic acid) is a double stranded helical structure which is made up of phosphate…
Q: DNA Structure and Replication 2 3 4 10 11 12 13 14 15 16 17 19 Across DOwn 1 Enzyme that "glues"…
A:
Q: How might the underwinding of a B-DNA helix facilitate or stabilize the formation of Z-DNA? Strands…
A: The B-DNA is the most relaxed form of DNA. Other forms of DNA that exist on nature are A-DNA, C-DNA,…
Q: Origin of replication [ Choose ] [ Choose ] Codon Complementary pairs with cytosine in a DNA…
A: Central dogma explains the flow of genetic material in an individual. It tells how the information…
Q: Which of the following statements is true about DNA? Select one: O a. The two strands of DNA are…
A: The DNA molecule is a polymer of nucleotides. Each nucleotide is composed of a nitrogenous base, a…
Q: 19 Across DOwn 1 Enzyme that "glues" Okazaki fragments together 4 Base that will pair with Thymine 5…
A: DNA replication is the process of producing complementary DNA from the parental DNA molecule.
Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…
A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is present in the…
Q: Because the polymerization of nucleotides is an endergonic process, energy is required for it to…
A: Nucleotides are the basic structure of nucleic acid such as DNA, RNA, etc which serves the main…
Q: Which of the following statement(s) is/are false/incorrect? You may select multiple options, if…
A: Introduction :- A DNA polymerase is an enzyme that catalyzes the manufacture of DNA molecules from…
Q: 1. Identify the complementary DNA bases for the following DNA sequence: ATT GGC TAG CCA * Your…
A: DNA stands for deoxyribonucleotide. DNA a is a long polymer of deoxyribonucleotides. Each…
Q: How are nucleotides formed?
A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…
Q: Match these replication associated terms with the appropriate definition or function. DNA consensus…
A: DNA replication is the process of making two identical copies of DNA from one single parent DNA.
Q: Select the statement(s) that accurately describe the function of DNA polymerase and the types of…
A: Mutation is a phenomenon that results in alteration of DNA sequences. This results in changes in the…
Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…
A:
Q: DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA…
A: Disclaimer: Since you have asked us two questions, we have offered the solution for the first one…
Q: What is the role of topoisomerase during DNA replication? To cut and re-glue (ligate) DNA, to…
A: Answer :- To cut and re-glue(ligate) DNA, to relieve coiling strain on the double helix ahead of the…
Q: Replication 1. The replication origin is identified. 2. DNA primase builds RNA primer. 3. Okazaki…
A: The opening of the double helix and separation of the DNA strands, priming of the template strand,…
Q: Synthesis of which strand requires the repeated action of DNA ligase?
A: DNA replication is a biological process that involves producing two identical DNA replicas from a…
Q: In DNA replication, which daughter strand is more likely to have a mutation? Select one: O a.…
A: DNA replication occurs differently in two different strand of DNA. The replication process in…
Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…
A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
mRNA operates as a template to allow DNA to replicate itself using ribosomes
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- AKS 5c1: The process represented in the model involves the creation of a molecule that is complementary to the template molecule. According to the model, what type of molecule is being created? * Nontemplate strand Polymerase Ribonucleotide Template strand New DNA Polypeptide O Messenger RNA Carbohydrate V 0 4:57 Sign out ET O O O Ond 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primerBONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
- Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guaninea. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
- art B-Processes occurring at a bacterial replication fork The diagram below shows a bacterial replication fork and its principal proteins. Drag the labels to their appropriate locations in the diagram to describe the name or function of each structure. Use pink labels for the pink targets and blue labels for the blue targ Replaces RNA primers with DNA nucleotides. Catalyzes phosphodiester bond formation, joining DNA fragments. Leading strand Breaks hydrogen bonds, unwinding DNA double helix. Synthesizes DNA 5' to 3 on leading and lagging strands. Lagging strand Coats single-stranded DNA, preventing duplex formation. Relaxes supercoiled DINA. Synthesizes RNA primers on leading and lagging strands. e Overall direction of synthesis reset ? helpReplication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?ANALYSIS 1: Given the following sequence of bases present in the DNA coding strand, what will be the sequence on the template strand, on the MRNA strand and on the peptide? Show the sequence of amino acids if A is inserted between C-6 and T-7. (5') CTT-AGC-TGG-CCC... (3') Key-in your answers in this manner: template strand (3') XXX-XXX-XXX-XXX (3') MRNA strand (5') XXX-XXX-XXX-XXX (3) Wild-type peptide AA1-AA2-AA3-AA4 Mutant peptide AA1-AA2-AA3-AA4 2 buse n codon A. Phe Phe Sir Lni tase ne uopes n s
- AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing ruleDuring DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C