A veterinarian suspects that a new disease of house cats is caused by a specific type of bacterium. Describe a set of procedures for providing this hypothesis. EXAMPLE GIVEN ON THE IMAGE. 1. The suspected disease-causing organism should always befound in animals with the disease.2. The organism must be isolated from the diseased animaland grown in a pure culture. (A pure culture is one containing onlyone kind of bacterium.)3. When organisms taken from the pure culture are injectedinto a healthy animal, they must cause the disease.identified as the same organism isolated in step 2.

The germ theory of disease was given by a German scientist named Robert Koch. He, in his theory,…

Answered: A veterinarian suspects that a new…

A veterinarian suspects that a new disease of house cats is caused by a specific type of bacterium. Describe a set of procedures for providing this hypothesis. EXAMPLE GIVEN ON THE IMAGE.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: The following three questions are related to this patient scenario: A 65-year-old male HIV patient…

A: The intravenous antibiotics are used to treat severe kinds of bacterial infections. A most common…

Q: what is the best research objectives for this research title? please enumerate Distribution of…

A: The research objectives are what the researcher expects to fulfill in the experiment.

Q: researcher wants to compare the pathogenicity of a mutant pathogen relative to wild type in an…

A: The term "pathogenicity" describes an organism's capacity to cause disease in its host. The overt…

Q: What is the morphology of the following cells: streptobacilli streptococci…

A: Bacterial shape is a very important method for their identification. Bacteria are roughly classified…

Q: CASE REPORT: While swimming in the creek, Anna slipped and a rock cut a three-inch gash in her leg.…

A: A microscopic organism made of one cell is referred to as a prokaryote. Prokaryotic organisms do not…

Q: Discuss the application of the following techniques in histopathology: 1.2.1. Immunohistochemistry…

A: Introduction Histopathology is the study of illness symptoms utilizing a microscopic examination of…

Q: Consider the five E. coli merodiploid strains listed here. Strain #1 I+P+O+Z-Y+/I+P+OcZ+Y+ Strain…

A: Promoter is cis-regulatory element. That means every operon have to have an active promoter (P+) to…

Q: Samples from an ill patient were collected by a physician for testing. A bacterial infection is…

A: Infections are the due to the activity of microbes in the body. Microbes can colonize in human body.…

Q: An elderly man with influenza acquires a case of pneumonia. Gram-positive cocci isolated from his…

A: Staphylococcus aureus (S. aureus) is a bacteria that causes a variety of illnesses. This strain has…

Q: Observe the results from a disc-diffusion experiment below. Which antibiotic would you prescribe to…

A: The objective of the question is to determine the most effective antibiotic for a patient with a…

Q: on the types of studies. Which sampling design you may recommend for the following experiments :…

A: Sampling methods play a very important role in investigation of various infection and disease either…

Q: Explain why only a virulent virus (like T4 phage), rather than a temperate virus, can be used in our…

A: If a virulent phage infects its host, it will produce more progeny as soon as phage DNA is injected…

Q: A virologist needs to remove all bacteria from a solution containing viruses without removing the…

A: Viruses are infectious organisms that are neither considered living or nonliving due to the fact…

Q: A urine sample with more than 100,000 organisms is considered indicative of infection. A urine…

A: Urine microscopy is a diagnostic tool used in diagnosis of various diseases such as bacterial…

Q: Lyme disease or zika virus https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5729143/…

A: Viruses are microscopic infectious agents that can only replicate inside the cells of living…

Q: Answer briefly and concisely: Over the past 100 years, several pandemics have occurred. Mention 3…

A: A pandemic is a global disease epidemic that affects large populations and geographic areas.…

Q: In the crusade to create a vaccine for Poliomyelitis, Jonas Salk and Albert Sabin created two…

A: Solvents is the substance in which solute is dissolved thus forming a solution. Usually a solvent is…

Q: You are working in a lab studying Streptococcus pyogenes as a cause of necrotizing fasciitiis. You…

A: Streptococcus pyogenes as a cause of necrotizing fasciitiis.

Q: A chronic IV drug user is admitted to the hospital after a suspected overdose. During recovery the…

A: Note : Hi. Thanks for your questions. Since, you have posted multiple questions, we will solve first…

Q: OTE: explain in a paragraph form How does PCR help in the identification of the virus from…

A: Polymerase chain reaction is a molecular biology technique for making a large number of copies of a…

Q: What would be the advantage of using stratified over quota sampling in this scenario?

A: The method of sampling that involves the division of a population into smaller subgroups (strata) is…

Q: Read the following study, construct the appropriate 2x2 table, calculate the measure of association,…

A: The objective of the question is to analyze the given epidemiological data, construct a 2x2 table,…

Q: Aside from the school laboratory facilities, How can we apply Aseptic Techniques in the following…

A: Aseptic techniques consist of laboratory procedures or practices that are carried out to get rid of…

Q: discuss how the bacterium Agrobacterium tumefaciens normally functions. Please also discuss how this…

A: Bacteria are a group of prokaryotic microscopic single celled organisms. They live in diverse…

Q: Samples from an ill patient were collected by a physician for testing. A bacterial infection is…

A: Infections are due to the entry of pathogenic microbes in the human body. They will colonize in many…

Q: Observe the results from a disc-diffusion experiment below. Which antibiotic would you prescribe to…

A: Based on the disc diffusion results, the Staphylococci bacteria are susceptible to some antibiotics…

Q: A patient sample will be analyzed. You are responsible to quantify the bacteria number. The dilution…

A: A sample of your blood, urine, skin, or any part of your body will be taken during a bacteria…

Q: _____________ is the analysis of the collective bacterialgenome in a particular environment.…

A: Microbes play important role in human health. Metagenomic study can examine the genomic composition…

Q: Strain #1 I+P+O+Z-Y+/I+P+OcZ+Y+ Strain #2 I+P+O+Z+Y+/I-P+OcZ+Y- Strain #3 I+P+O+Z-Y+/I-P+OcZ+Y-…

A: Lac operon breaks down lactose into glucose and galactose. The lac operon is present in bacterial…

Q: You currently work in a BLS 2 lab with organisms that are classified as BSL 1 or 2. Your project…

A: 1). Working with microorganisms not comprehended to infect healthy humans with sickness is…

Q: Describe the chemical differences which make males less likely to get bacterial diseases, but…

A: These are the infections that are primarily caused by bacteria. Like cholera,syphilis, anthrax.

Q: The epidemiological or disease triangle is a model of disease causation that proposes three factors…

A: Disease biology is a vast area that deals with the emergence and spread of an infectious disease.…

Q: What is the diffrence simular from BA in Biology and BS Biology. What jobs can I get with both? Can…

A: The main difference between a Bachelor of Arts (BA) and Bachelor of Science (BS) in Biology is the…

Q: Of the family of viruses we've studied, what type of virus is HIV (human immunodeficiency virus)?…

A: A virus is an infectious microbe made up of a nucleic acid segment (either DNA or RNA) surrounded by…

Q: If the pneumonia is caused by bacteria , could you use Koch's postulates? In which case of bacterial…

A: Robert Koch is a German physician who developed Koch postulates. They define the relationship…

Q: (there are multiple right answers to this homework question but I can't tell which one is right) You…

A: "That the isolate is genomically stable so you can study it":Genomic stability is crucial because it…

Q: Consider the five E. coli merodiploid strains listed here. Strain #1 I+P+O+Z-Y+/I+P+OcZ+Y+ Strain…

A: Lac operon breaks lactose into glucose and galactose. The lac operon is present in genome of E.…

Q: You are provided with a sewage wastewater sample to assess for the presence of bacteriophages.…

A: Bacteriophages are virus which attack, infect and divides within bacterial cells, and archaea…

Q: Most hospitals use hand sanitizers that claim to “kill 99.99% of illness causing germs”. What are…

A: Maintaining a clean work environment is critical in preventing different types of illness. Bacteria…

Q: If you were an epidemiologist interviewing someone with an infectious disease that could lead to an…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: A screening test for a disease is being evaluated against the current screening test (e.g., the gold…

A: The objective of this question is to calculate the positive predictive value (PPV) of a new…

Q: An inter-strand grouping of students is working on a study about the Copper-infused materials…

A: Several heavy metals have the potential to inhibit the growth of the microbes, virus or the bacteria…

Q: The park grounds keepers recently applied high nitrogen fertilizer to the grass surrounding the…

A: The above-give image is of Cyanobacteria. Cyanobacteria or blue-green algae are a group of bacterial…

Question

100%

A veterinarian suspects that a new disease of house cats is caused by a specific type of bacterium. Describe a set of procedures for providing this hypothesis. EXAMPLE GIVEN ON THE IMAGE.

1. The suspected disease-causing organism should always be
found in animals with the disease.
2. The organism must be isolated from the diseased animal
and grown in a pure culture. (A pure culture is one containing only
one kind of bacterium.)
3. When organisms taken from the pure culture are injected
into a healthy animal, they must cause the disease.
identified as the same organism isolated in step 2.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What are three public health measures that could reduce the probability that bacteria will develop resistance to antibiotics? Be specific in your description, and remember to include evidence to support your answer. write a brief paragraph for each one of them. Be sure to include links / citations / references to support your answers.
For the following diseases, mention the causative organism, category to which the organism belongs, symptoms as well as possible treatment option for the following diseases in a table, the symptoms and treatment options should be written pointwise:
What is the term used to refer to the application of the scientii c method to evaluate alternative treatment methods and create guidelines for similar clinical situations?
The epidemiological or disease triangle is a model of disease causation that proposes three factors contribute to an outbreak – an agent that causes the disease, a susceptible host, and an environment that brings the host and agent together. Some general changes within these three factors that may cause an infectious disease to emerge include: A. changes in populations or behavior of reservoir hosts or intermediate hosts B. microbial genetic mutation and viral genetic recombination or assortment C. environmental factors such as an increase in precipitation D. all of the above E. none of the above
Why is it vital that a biomedical technician without patient interaction understand infection control when retrieving medical equipment?
The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies serovar Typhimurium strain obtained from the NCBI database. ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG CAAAAACTAA (i) Is the nucleotide sequence above translatable into a complete protein? Give justification. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer. (iii) Liliana, a research officer would like to perform a multiple sequence alignment between the sequence above with eight other toxin genes sequences obtained from other researchers. Define multiple sequence alignment. (iv) Which multiple sequence alignment program would you recommend…
explain how does koch's postulates apply to the diagnosis of plant virus diseases today.
In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 100, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 15,000. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? Group of answer choices There is no way to know given the information provided Both infections are equally likely Parasiticum mucoides Donoteatum thisbacterium
In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? There is no way to know given the information provided Both infections are equally likely Donoteatum thisbacterium Parasiticum mucoides
go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…
1) How does cholera kill people? 2) What was Dr. Snow's initial hypothesis on the cause of cholera? 3) What methods did Dr. Snow use to test his hypothesis? 4) What was "The Report That Changed The World" ? 5) What is a voronoi diagram? 6) What is the definition of an "A B Test" ? 7) Name a place where cholera is still a problem today. 8)What public health policies would you apply to help that place?
In lehman terms define what is a bacterial disease? keep it simple. Strictly no plagiarism.