The sequence shown below is an actual sequence of the toxin gene from Salmonellaenterica subspecies serovar Typhimurium strain obtained from the NCBI database.ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAAGCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCTCAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTATGCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATGCTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAGCAAAAACTAA(i)Is the nucleotide sequence above translatable into a complete protein? Give justification.(ii) Is the sequence above represented in the standard FASTA format? Explain your answer.(iii) Liliana, a research officer would like to perform a multiple sequence alignment betweenthe sequence above with eight other toxin genes sequences obtained from otherresearchers. Define multiple sequence alignment.(iv) Which multiple sequence alignment program would you recommend to Liliana for thecomparison of the toxin sequence above with other toxin genes from other organisms?

Answered: The sequence shown below is an actual…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Question

The sequence shown below is an actual sequence of the toxin gene from Salmonella
enterica subspecies serovar Typhimurium strain obtained from the NCBI database.
ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA
GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT
CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT
GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG
CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG
CAAAAACTAA
(i)
Is the nucleotide sequence above translatable into a complete protein? Give justification.
(ii) Is the sequence above represented in the standard FASTA format? Explain your answer.
(iii) Liliana, a research officer would like to perform a multiple sequence alignment between
the sequence above with eight other toxin genes sequences obtained from other
researchers. Define multiple sequence alignment.
(iv) Which multiple sequence alignment program would you recommend to Liliana for the
comparison of the toxin sequence above with other toxin genes from other organisms?

Expert Solution

Step 1

The process of DNA sequencing is used to ascertain the nucleotide sequence of deoxyribonucleic acid. The most fundamental understanding of a gene or genome is its nucleotide sequence.

Without having this knowledge, it is impossible to fully comprehend how genes function or how organisms evolve. It is the blueprint that holds the instructions for developing an organism.

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions