A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correctorientation)?O 5'- GAG GTG AAA - 3'Q5' - AAA GTG GAG - 3'3' - UUU CAC CỤC - 3'3' - CUC CAC UUU - 5'O glu - val - lys

Step 1 Base pairing is formed in DNA (Deoxyribonucleic acid) double helix between purine of one…

Answered: A template DNA strand for transcription…

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Original Sequence : 3’TAC ACC TTG GCG ACG ACT’S
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
Dna sense strand : 5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT GCT CCA CAA ACT 5' what is the amino acid sequence for this peptide?
The partial sequence of a gene Question 2 coding strand is: 5'-TACGATCATAT-3. This sequence is transcribed. What is the sequence of the corresponding RNA? A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3’ C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5’ E 5'-TATACTAGCAT-3’
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
What is the template strand, RNA strand, Amino acid sequence, and Amino acid sequence in one letter abbreviation. 5' ATG GCT CGC ATG ACG GCC AAG TGA 3'
Original Sequence : 3’TAC ACC TTG GCG ACG ACT’S
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
What are the particular changes in the gene and protein sequences shown on the screen? Name the codons and amino acids.
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q

SEE MORE QUESTIONS

Recommended textbooks for you

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys