A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys

A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: • Using the RNA base abbreviations hairpin structure below which would allow a stable hairpin to…

A: DNA is usually present as double-stranded molecules. The A-, B-, and Z-form of DNA are the three…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from parents to their…

Q: 1. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b.…

A: Promoter is a region on the DNA where RNA polymerase enzyme binds for the process of transcription.…

Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…

Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…

A: Transcription: The process of synthesis of mRNA transcript from double stranded DNA template by the…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…

Q: antisense DNA strand?

A: Sense strand: This is the segment of double stranded DNA which runs from 5' to 3' direction. This…

Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…

A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…

Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…

A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: GENE TABLE 1: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GAA CAG GTG GTT CCA AAG…

A: The central dogma of life involves the following three steps. Replication: DNA replicates to make…

Q: ment Sialic acid receptor U 44442 Endosome HA -NA B Com wwwwww AAAAAD 2 Endocytosis ADAA Host cell 3…

A: Influenza virus is an enveloped RNA virus. It contains a protein capsid and a single-stranded…

Q: In bacteria which ribozyme catalyzes synthesis of peptide bonds between amino acids? 16S rRNA 5S…

A: the translation is the process by which the messenger rna is converted into polypeptide .

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: DNA Sense strand: 5' ATG TTT CAA CGA GGT GTT TGA 3' DNA Anti-sense strand: 3' TAC AAA GTT…

A: Transcription is a process in gene expression where a particular segment of DNA is copied into RNA.…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing…

A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: 7 Pribnow box Sigma factor Hogness box Aminoacyl tRNA synthase Rho factor 8 DNA pol 5 hnRNA RNA pol…

A: Central dogma explains the flow of genetic information in all cells. The three main processes:…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems. It…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of DNA, it is known as transcription. Transcription is…

Q: O5-CAGCAUUA-3'

Q: Dna sense strand : 5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: у OH ON Replication. OH

A: Molecular biology is a branch of biology that focuses on the study of biological molecules and their…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base…

A: In DNA Adenine, Guanine, Cytosine, and Thymine are present as nitrogen bases. Adenine(A) binds with…

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: Draw the protein: SRDR

A: Amino acids are organic compounds that are made up of nitrogen, carbon, hydrogen, and oxygen, along…

Q: utation rates than DNA viruses such as Herpes viruses? olymerases which copy viral RNA have much…

A: Viruses may be either composed of RNA or DNA. The Genome is surrounded by a protein coat called…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Question

A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct
orientation)?
O 5'- GAG GTG AAA - 3'
Q5' - AAA GTG GAG - 3'
3' - UUU CAC CỤC - 3'
3' - CUC CAC UUU - 5'
O glu - val - lys

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3' 5'-UUC-3' 3'-UUC-5'
Kindly refer to the photo
Give typed explanation
What is the corresponding mRNA sequence of the polymer? 3'CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5'
transcrine THIS dna to rna
The diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The bottom strand is the template strand. 5'-GCATATGCGGTAC-3' 3'-CGTATACGCCATG-5' Give the sequence found on the RNA molecule that is transcribed from the above DNA molecule. Enter your answer from 5' to 3'. 5'- -3'
Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG
If the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be: 5’AUGGCAU 3' ОЗ ТАССGTA 5' 3' UACGGUA 5' 5' ATGGCAT 3' O 5' UACGGUA 3'
Which RNA polymerase makes TRNA? RNA pol I RNA pol II RNA pol III RNA pol IV
The complement to a coding strand has the sequence 5' - TACTTTAGGATC - 3'. What is the MRNA strand for this sequence?
E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10