A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys

A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct orientation)? O 5'- GAG GTG AAA - 3' Q5' - AAA GTG GAG - 3' 3' - UUU CAC CỤC - 3' 3' - CUC CAC UUU - 5' O glu - val - lys

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: • Using the RNA base abbreviations hairpin structure below which would allow a stable hairpin to…

A: DNA is usually present as double-stranded molecules. The A-, B-, and Z-form of DNA are the three…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from parents to their…

Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: 1. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b.…

A: Promoter is a region on the DNA where RNA polymerase enzyme binds for the process of transcription.…

Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…

A: Transcription: The process of synthesis of mRNA transcript from double stranded DNA template by the…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…

A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…

Q: antisense DNA strand?

A: Sense strand: This is the segment of double stranded DNA which runs from 5' to 3' direction. This…

Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…

A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…

Q: What is the sequence of amino acids for if the DNA sequence given is (remember direction RNA…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: Label each element involved in bacterial transcription in the figure. 3' 5' AACTGT TTGACA -35…

A: Transcription is the process by which there occurs synthesis of mRNA from the DNA. This process…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: ment Sialic acid receptor U 44442 Endosome HA -NA B Com wwwwww AAAAAD 2 Endocytosis ADAA Host cell 3…

A: Influenza virus is an enveloped RNA virus. It contains a protein capsid and a single-stranded…

Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…

A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: 7 Pribnow box Sigma factor Hogness box Aminoacyl tRNA synthase Rho factor 8 DNA pol 5 hnRNA RNA pol…

A: Central dogma explains the flow of genetic information in all cells. The three main processes:…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of DNA, it is known as transcription. Transcription is…

Q: Second letter UUU UCU UCC UAU UAC UGU Tyr Phe UUCJ UUA UUG. UCA UCC Ser UAA Stop UGA Stop A UAG Stop…

A: 1)Codon on mRNA strand which codes for Methionine is AUG from 5' to 3' direction. This is an…

Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3

A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…

Q: Dna sense strand : 5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: Trancription It refers to the process of copying the genetic sequences of DNA into mRNA. Translation…

Q: Why do you think this substituion is named " NonSense". In your response explain what it means to…

A: Mutation Mutation is the error in DNA. When a single base or more than one bases are change in the…

Q: у OH ON Replication. OH

A: Molecular biology is a branch of biology that focuses on the study of biological molecules and their…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: Matching type Choices are in the picture 1. Puromycin 2. Amanitin 3. Tetracycline 4. Rifampicin…

A: DNA acts as the genetic material in most organisms. DNA is first transcribed into mRNA with the help…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base…

A: In DNA Adenine, Guanine, Cytosine, and Thymine are present as nitrogen bases. Adenine(A) binds with…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: Ser STP Tyr Val Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA:…

A: DNA :CAT AGG GAG CAA GGG TGA CTT TTT AAT AAT GAC GGG RNA: CAU AGG GAG CAA GGG UGA CUU UUU AAU AAU…

Question

A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence (with correct
orientation)?
O 5'- GAG GTG AAA - 3'
Q5' - AAA GTG GAG - 3'
3' - UUU CAC CỤC - 3'
3' - CUC CAC UUU - 5'
O glu - val - lys

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Give only typing answer with explanation and conclusion
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
Please help me with answer
LABEL IMAGE WITH THESE TERMS TRANSCRIPTION DNA MRNA AND PROTEIN ALSO CIRCLE EACH CODON
What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3' 5'-UUC-3' 3'-UUC-5'
The diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The bottom strand is the template strand. 5'-GCATATGCGGTAC-3' 3'-CGTATACGCCATG-5' Give the sequence found on the RNA molecule that is transcribed from the above DNA molecule. Enter your answer from 5' to 3'. 5'- -3'
The first nucleotide in mRNA that will be synthesized from DNA below is: 3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'
Which RNA polymerase makes TRNA? RNA pol I RNA pol II RNA pol III RNA pol IV
The complement to a coding strand has the sequence 5' - TACTTTAGGATC - 3'. What is the MRNA strand for this sequence?
2. please answer this asap
E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10
What is the template strand, RNA strand, Amino acid sequence, and Amino acid sequence in one letter abbreviation. 5' ATG GCT CGC ATG ACG GCC AAG TGA 3'