A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: Use the genetic code below to determine the third amino acid in the protein translated from the…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by the…

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA,…

A: The synthesis mRNA from double-stranded DNA requires the enzyme RNA polymerase II, this enzyme will…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: If the mRNA transcribed for this gene will be translated into a functional protein, how many amino…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.